ID: 1084396164

View in Genome Browser
Species Human (GRCh38)
Location 11:68911895-68911917
Sequence GAGCACGAGCACAGCAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084396164_1084396172 13 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396172 11:68911931-68911953 CCCGTGCAGGGGCCTGGAGTTGG 0: 1
1: 0
2: 2
3: 28
4: 265
1084396164_1084396169 2 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1084396164_1084396175 19 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396175 11:68911937-68911959 CAGGGGCCTGGAGTTGGCCTGGG 0: 1
1: 0
2: 9
3: 52
4: 475
1084396164_1084396170 7 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396170 11:68911925-68911947 TGCACGCCCGTGCAGGGGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 138
1084396164_1084396167 1 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396167 11:68911919-68911941 TCCGTGTGCACGCCCGTGCAGGG 0: 1
1: 0
2: 2
3: 6
4: 56
1084396164_1084396176 24 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396176 11:68911942-68911964 GCCTGGAGTTGGCCTGGGCCCGG 0: 1
1: 0
2: 6
3: 48
4: 524
1084396164_1084396166 0 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396166 11:68911918-68911940 CTCCGTGTGCACGCCCGTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 65
1084396164_1084396174 18 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396174 11:68911936-68911958 GCAGGGGCCTGGAGTTGGCCTGG 0: 1
1: 0
2: 3
3: 53
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084396164 Original CRISPR GAGCACGAGCACAGCAAGCG TGG (reversed) Intronic
901123250 1:6911807-6911829 GAGCCCGCAGACAGCAAGCGAGG - Intronic
901731478 1:11283287-11283309 GAAAACAAGCACAGCAAGAGTGG + Intronic
902060513 1:13638238-13638260 TATCACAAGAACAGCAAGCGGGG + Intergenic
906606301 1:47174792-47174814 GACCAGGAGCACAGCCAGCCAGG + Intergenic
918071525 1:181136883-181136905 GAGCACGCACACAGACAGCGGGG + Intergenic
919774592 1:201185766-201185788 GGGCAGGAGCCCAGCAAGGGAGG - Intergenic
922144636 1:222928246-222928268 GAGCACAAGGTCAGCAAGCCAGG - Intronic
922421274 1:225462446-225462468 GAGCATGAGCCCAGCCAGGGTGG - Intergenic
923102316 1:230826400-230826422 GAGAAAGAGCACAGCAAGAGGGG + Intergenic
924947509 1:248856248-248856270 GAGAATGAGCAGAGCAAGAGAGG - Intronic
1074134933 10:110618024-110618046 GGGAATGAGCTCAGCAAGCGGGG + Intergenic
1076242601 10:128920979-128921001 CATCACGAGAACAGCAAGGGGGG + Intergenic
1078597118 11:12697097-12697119 GAGCACGGGGAAAGCAAGCCAGG + Intronic
1081909961 11:46694400-46694422 GAGGACAAGCACAGCGAGCCAGG + Intronic
1083235049 11:61345808-61345830 GAGCACGGGCCCTGCAACCGAGG - Intronic
1083717335 11:64585119-64585141 GCACACGAGCACAGCCAGCGTGG + Intergenic
1084022677 11:66427014-66427036 CACCACGAGCACTGCAAGCCTGG - Intergenic
1084396164 11:68911895-68911917 GAGCACGAGCACAGCAAGCGTGG - Intronic
1087006749 11:93479061-93479083 GAGCACGACCACGGCCAGCGTGG + Exonic
1098544293 12:71694290-71694312 GTGGAAGAGCACAGCAAGAGGGG + Intronic
1107130409 13:36888249-36888271 TATCACGAGAACAGCAAGAGGGG - Intronic
1107840549 13:44452481-44452503 GAGCCCGAGCACAGGGAGCCTGG + Intronic
1110283475 13:73722232-73722254 GACCACAAGCAGAGCAAGAGTGG + Intronic
1112294708 13:98176791-98176813 GAGCACGACCACATCTACCGGGG - Exonic
1112810796 13:103216377-103216399 GAGGAGGAGCACAGCCAGAGTGG - Intergenic
1119173067 14:72549385-72549407 GAGCCCCAGCACAGCCAGGGTGG + Intronic
1122406858 14:101505866-101505888 GAGCAAGGGCCCAGCCAGCGGGG - Intergenic
1122923244 14:104888534-104888556 GTCCATGGGCACAGCAAGCGGGG + Intronic
1122950732 14:105043084-105043106 GAGCAAGAGCCCAGGAAGCCAGG - Intergenic
1124595883 15:31091208-31091230 GATCTCCAGCACAGCAGGCGAGG - Intronic
1127578379 15:60314421-60314443 CAGCATGAGAACAGCAAGGGGGG + Intergenic
1128659789 15:69490453-69490475 GAGAACCAGGAGAGCAAGCGTGG - Intergenic
1133239859 16:4407955-4407977 GAGCCCGAGGACAGCAGGTGGGG - Intronic
1139474690 16:67197264-67197286 GAGCAGGTGCTCAGCAAGGGTGG + Intronic
1140125928 16:72119087-72119109 GAGCATGAGCACAGCAGTTGTGG - Exonic
1142312929 16:89324306-89324328 GAGCACGGACACAGCAGTCGGGG + Intronic
1147244195 17:39109629-39109651 GAGCATGAGGGCAGCAGGCGTGG - Intronic
1151471644 17:74322068-74322090 GAGCACGGCCAGAGCAAGGGTGG + Intergenic
1151800843 17:76378764-76378786 GAGCAGGAGCACAGGAAGTCTGG + Intronic
1155125671 18:22873127-22873149 TATCACGAGAACAGCAAGTGGGG + Intronic
1162983743 19:14256122-14256144 TATCACAAGCACAGCAAGGGAGG + Intergenic
1163239586 19:16052262-16052284 GCGCACGAGCACAGAGAGCCGGG - Intergenic
1163462630 19:17448226-17448248 GAGCACCAGCGCGGCCAGCGCGG + Exonic
1167509799 19:49890016-49890038 GAGGACCAGCACAGCCAGGGTGG - Exonic
925723964 2:6855231-6855253 CATCACGAGAACAGCAAGGGGGG - Intronic
926646702 2:15297462-15297484 CATCACGAGAACAGCAAGGGGGG - Intronic
929559474 2:42946777-42946799 GAGCAGAAACAGAGCAAGCGCGG + Intergenic
931549169 2:63424031-63424053 GAGCACCAGGACAGCAATCCTGG + Intronic
932475316 2:72002409-72002431 GAGAAAGAGCAGAGCCAGCGTGG + Intergenic
935941081 2:108239967-108239989 AAGCAAGAGCACAGCAGGTGAGG - Intergenic
943308769 2:186300713-186300735 TATCACGAGAACAGCAAGAGGGG + Intergenic
944046045 2:195413425-195413447 GAGGAAGAGCACAGCAATCGTGG + Intergenic
946009396 2:216552854-216552876 GAGCCAAAGCACAGCAAGCATGG - Intronic
946709449 2:222491546-222491568 TATCACGAGAACAGCATGCGGGG + Intronic
947718415 2:232353037-232353059 GACCCAGAGCACAGCAATCGCGG + Intergenic
947724615 2:232388963-232388985 GACCCAGAGCACAGCAATCGCGG + Intergenic
948858349 2:240740990-240741012 GAGCACTAGGACAGCAAACCAGG - Intronic
1180147684 21:45930372-45930394 GAGCAAGAGCACAGCTGACGTGG + Intronic
1180873461 22:19161843-19161865 GAGCAGGAGCACAGACAGCCGGG - Intergenic
1181088346 22:20455352-20455374 GATCAAGAGCAGAGCAAGCGAGG - Intronic
1181106580 22:20579322-20579344 GAGCACGAGAGCAGGAAGCCAGG - Intronic
1181281333 22:21722810-21722832 GAGTAAGAGCACAGGAAGTGAGG + Intronic
1181459636 22:23078544-23078566 GAGCCCCAGAACAGCCAGCGTGG - Intronic
1182317016 22:29454390-29454412 GAGCAGGCCCACAGCAGGCGCGG + Intergenic
1185411095 22:50683562-50683584 GGGGACGAGCCCAGCACGCGAGG + Intergenic
950005382 3:9687991-9688013 GAGCACCAGCCCAACAAGCAGGG - Intronic
952068045 3:29595960-29595982 GAGCAAGAGCTCAGCAAGCGTGG - Intronic
954879278 3:53822882-53822904 GACCAGGAGCACAGCCAGAGGGG + Intronic
960955435 3:123027629-123027651 GAGCCCGAGCGCAGCGGGCGCGG - Intronic
961413953 3:126743997-126744019 GAGCAGGGGTACAGCAAGCATGG - Intronic
968977978 4:3831599-3831621 GAGCACGGGCACAGCGGGAGTGG - Intergenic
970291607 4:14578913-14578935 GAGCACGAGATCAGCATGGGAGG + Intergenic
972386802 4:38574849-38574871 CAGCACGAGCAGAGAAAGCAGGG - Intergenic
973763205 4:54139671-54139693 GAGGGAGAGCACAGCAACCGGGG + Intronic
975498251 4:75057702-75057724 GAGCACGTGCACACCCAGCCAGG - Intergenic
975788579 4:77922337-77922359 GAGGACTAGCATAGCTAGCGTGG + Intronic
976700723 4:87966396-87966418 GAGCATGCGCACAGCCAGCTGGG - Intergenic
980671082 4:136008397-136008419 GAGCACGTGCACACCAAGCTGGG - Intergenic
983469803 4:168142279-168142301 GAGCAGGAACAAAGCAAGCAAGG - Intronic
983575271 4:169254791-169254813 GAACCCAAGCACAGCAAGCAGGG + Intronic
986763251 5:10899124-10899146 GAAGACGAGCACAGGAAGGGAGG + Intergenic
990548652 5:56850173-56850195 GAGGAAGAGGACAGCAAGGGAGG - Intronic
994929749 5:106166383-106166405 TATCACGAGAACAGCAAGAGGGG - Intergenic
997296950 5:132774436-132774458 GAGGAGGGGCACAGCAAGAGTGG + Intronic
997837537 5:137207773-137207795 GAGCATGAGCAGAGCAGGCTCGG - Intronic
1005942546 6:30571544-30571566 GAGCACGAGCCCATCAGGTGAGG + Exonic
1011933534 6:92743817-92743839 GAACACAAGAACAGCAAGGGGGG - Intergenic
1017220800 6:151963099-151963121 GAGCAAGAGCAAAGGAAGGGAGG - Intronic
1018857386 6:167684561-167684583 TATCACGAGAACAGCAAGGGGGG + Intergenic
1022171610 7:27837311-27837333 GAGCATGAGCAGGGCAAGGGTGG + Intronic
1026275569 7:68872777-68872799 GAAGTAGAGCACAGCAAGCGAGG - Intergenic
1035050928 7:155998751-155998773 GAGGACGAGGACAACAAGCACGG + Intergenic
1039422520 8:37454963-37454985 CAGCAAGAGCACAACAAGCTTGG - Intergenic
1040721104 8:50324271-50324293 GAGGAAGAGCACAGCAACTGAGG - Intronic
1041177228 8:55209302-55209324 GGGAACGAGGACAGCAAGTGTGG - Intronic
1041347107 8:56910754-56910776 GAGCAAGAGCACAGGGAGGGAGG + Intergenic
1047092993 8:121594181-121594203 GAGCAAGAGCACAGCATCAGAGG + Intergenic
1056721303 9:89074324-89074346 GAGCCGGGGCACAGCAAGGGAGG + Intronic
1061654958 9:132082403-132082425 TATCACGAGAACAGCAAGGGGGG + Intergenic
1188060046 X:25590285-25590307 GAGCACAAGCCCATCAAGCCTGG - Intergenic
1190301905 X:49062018-49062040 GAGTGAGAGCACAGCAAGTGGGG - Exonic
1199138998 X:144287958-144287980 GAGGGAGAGCACAGCAAGTGAGG - Intergenic
1201368525 Y:13235123-13235145 GAGCATGAGCACAGCTGGCCGGG + Intergenic