ID: 1084396169

View in Genome Browser
Species Human (GRCh38)
Location 11:68911920-68911942
Sequence CCGTGTGCACGCCCGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084396162_1084396169 27 Left 1084396162 11:68911870-68911892 CCCTGGGTCAGGGTTTATTTGTT 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1084396164_1084396169 2 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1084396163_1084396169 26 Left 1084396163 11:68911871-68911893 CCTGGGTCAGGGTTTATTTGTTC 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084396169 Original CRISPR CCGTGTGCACGCCCGTGCAG GGG Intronic
900215585 1:1479875-1479897 GCGTGTGCATGCCCGTGTGGGGG - Intronic
900577694 1:3391830-3391852 CCCTGTGCACGCCTGTGCTTGGG - Intronic
902148629 1:14424538-14424560 CCATGTGAATGGCCGTGCAGTGG - Intergenic
905629105 1:39509017-39509039 CTGTGGGGACGCCCGTGCTGTGG - Intronic
912501649 1:110126626-110126648 CCCTGTGGAAGCCCCTGCAGTGG + Intergenic
919381785 1:196869442-196869464 CCTTGGGCACTCCCTTGCAGAGG - Intronic
920297705 1:204969152-204969174 GTGTGTGCATGCCCGTGCATGGG + Intronic
1064769572 10:18710420-18710442 CCGCCTGCACGCCCGGGTAGGGG - Intergenic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1074756505 10:116627804-116627826 CCGTGTGCGCGCCCAGGCTGTGG - Exonic
1074787783 10:116856586-116856608 CGGTGAGCACCGCCGTGCAGTGG + Exonic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1124142840 15:27092586-27092608 CCGTGTGAGCTGCCGTGCAGCGG + Intronic
1126746297 15:51829619-51829641 GCGTGCGCACTCCCGTGCCGCGG - Exonic
1139418206 16:66831256-66831278 CAGTGTGCTCACCTGTGCAGTGG + Intronic
1142142085 16:88476991-88477013 ACGTGCGCACGCCCGTGCGCCGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1160861703 19:1239979-1240001 CCGTGTTCAGGCCAGTGCAATGG - Intergenic
1161953036 19:7478219-7478241 CCCTGTGCAGGCCCATGCTGGGG - Intronic
1165171437 19:33894737-33894759 GCGTGTGCACGGCATTGCAGTGG - Intergenic
1165171455 19:33894841-33894863 GCGTGTGCACGGCATTGCAGTGG - Intergenic
1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG + Intergenic
925350230 2:3196106-3196128 CTTTGTGCACGTCCGTGCAGAGG - Intronic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
934686873 2:96327572-96327594 ACGTGTGCAAGACTGTGCAGTGG + Exonic
937042996 2:118835626-118835648 CCGGGTGCACCCCGCTGCAGAGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175863927 20:62164478-62164500 CCGCGTGGAGGCCAGTGCAGCGG - Intronic
1184715702 22:46280581-46280603 CCGTGGGCACCCCTGGGCAGGGG - Intronic
1185351820 22:50343488-50343510 CCGTGTGGAGGCCCGAGCGGAGG - Exonic
960281247 3:115783980-115784002 CCGTGTGCGCGCGCGTGTCGGGG + Intergenic
962839196 3:139218291-139218313 CCCTGTGCAGGCCTGTGCAAAGG - Intronic
969266098 4:6065074-6065096 TCGTGGGCATGCCAGTGCAGGGG + Intronic
976262344 4:83157798-83157820 CTCAGTGCACGCCAGTGCAGTGG + Intergenic
978689023 4:111484148-111484170 CCTTGGGCACCCCAGTGCAGTGG + Intergenic
980340442 4:131538185-131538207 ACGTGTGCATGCACGTGCAATGG + Intergenic
980974911 4:139601220-139601242 CCCTCTGCACGCCCAAGCAGCGG - Intronic
981597685 4:146445917-146445939 ACGTGCGCACGCGCGTGCACGGG + Intronic
985895918 5:2750077-2750099 CTGTGTGCGCGCACGTGCAAGGG - Intronic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
997479789 5:134176624-134176646 CCGTGAGGACGCCCGGCCAGAGG + Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018576344 6:165264049-165264071 CTGTGTGCAGGCCAGTGCTGGGG - Intergenic
1018996470 6:168714142-168714164 CTGTGGTCACGCCCATGCAGGGG + Intergenic
1033477238 7:141702355-141702377 CCGTGTGCACGTCCGTGTGTGGG + Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG + Intronic
1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG + Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1059484911 9:114619270-114619292 ACGCGTGCACGCACGCGCAGAGG - Intronic
1060544703 9:124453128-124453150 CCGCGTGTACTCACGTGCAGTGG + Exonic
1061489664 9:130938251-130938273 CCTGGTGCACGCGGGTGCAGAGG - Intronic
1062044776 9:134419960-134419982 CCGTGTGCCCACTCCTGCAGAGG + Intronic
1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG + Intronic