ID: 1084396169

View in Genome Browser
Species Human (GRCh38)
Location 11:68911920-68911942
Sequence CCGTGTGCACGCCCGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084396164_1084396169 2 Left 1084396164 11:68911895-68911917 CCACGCTTGCTGTGCTCGTGCTC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1084396162_1084396169 27 Left 1084396162 11:68911870-68911892 CCCTGGGTCAGGGTTTATTTGTT 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1084396163_1084396169 26 Left 1084396163 11:68911871-68911893 CCTGGGTCAGGGTTTATTTGTTC 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084396169 Original CRISPR CCGTGTGCACGCCCGTGCAG GGG Intronic