ID: 1084398238

View in Genome Browser
Species Human (GRCh38)
Location 11:68928939-68928961
Sequence TTTTGCCAATTGAAGATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 319}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084398237_1084398238 -7 Left 1084398237 11:68928923-68928945 CCGAAGGGGTGATTAATTTTGCC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1084398238 11:68928939-68928961 TTTTGCCAATTGAAGATCAGAGG 0: 1
1: 0
2: 1
3: 36
4: 319
1084398235_1084398238 -5 Left 1084398235 11:68928921-68928943 CCCCGAAGGGGTGATTAATTTTG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1084398238 11:68928939-68928961 TTTTGCCAATTGAAGATCAGAGG 0: 1
1: 0
2: 1
3: 36
4: 319
1084398236_1084398238 -6 Left 1084398236 11:68928922-68928944 CCCGAAGGGGTGATTAATTTTGC 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1084398238 11:68928939-68928961 TTTTGCCAATTGAAGATCAGAGG 0: 1
1: 0
2: 1
3: 36
4: 319
1084398231_1084398238 15 Left 1084398231 11:68928901-68928923 CCTTGGGCTTGGGGTCACAGCCC 0: 1
1: 0
2: 2
3: 28
4: 305
Right 1084398238 11:68928939-68928961 TTTTGCCAATTGAAGATCAGAGG 0: 1
1: 0
2: 1
3: 36
4: 319
1084398230_1084398238 16 Left 1084398230 11:68928900-68928922 CCCTTGGGCTTGGGGTCACAGCC 0: 1
1: 0
2: 1
3: 10
4: 200
Right 1084398238 11:68928939-68928961 TTTTGCCAATTGAAGATCAGAGG 0: 1
1: 0
2: 1
3: 36
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084398238 Original CRISPR TTTTGCCAATTGAAGATCAG AGG Intronic
903172359 1:21562311-21562333 TGTTACAAATTGAAGATCTGTGG - Intronic
904405055 1:30283013-30283035 ATTTTCAAATTGAAGATCTGGGG - Intergenic
905046635 1:35008916-35008938 ATTTGCAAACTGAGGATCAGAGG + Exonic
905573757 1:39026831-39026853 GTTCGCCAAGTGAAGATCAGTGG - Intronic
906137527 1:43509943-43509965 TCTTGCCAATTGAAGTTCTGCGG + Intergenic
906855523 1:49300329-49300351 TTTTACCAATTAATGAACAGAGG - Intronic
907727969 1:57037788-57037810 GTTTGGCAATTGAAGAACAAGGG + Intronic
909844035 1:80367780-80367802 TTTTACAAATTGAAGATCTGTGG + Intergenic
910344977 1:86226225-86226247 TTTTGCAAATTGAAGTTTTGTGG - Intergenic
910491954 1:87782520-87782542 TCCTGCCAACTGAAGATCAGTGG - Intergenic
910845188 1:91598658-91598680 TTTTACTAATTGAAGGTCTGTGG - Intergenic
911649664 1:100373532-100373554 TTTTACAAATTGAAGAACCGTGG - Intronic
912954108 1:114140738-114140760 TTTTACAAATTGAAGATTTGTGG + Intronic
915702324 1:157807636-157807658 GTTTACCAATTTCAGATCAGAGG + Intronic
916541339 1:165757898-165757920 TGTTGCCAATTTAAGGACAGAGG + Intronic
917192291 1:172430753-172430775 TTTTACAAATTGAAGATTTGTGG + Intronic
917238982 1:172926657-172926679 TTTTACCAATTGAAGGTTTGTGG - Intergenic
917736816 1:177929010-177929032 CTTTGCAAATTGATGTTCAGAGG - Intronic
919266676 1:195275944-195275966 TTATGCCATTTGAAGGTCAATGG + Intergenic
919544778 1:198901970-198901992 TTTTGCCAACTGAAGAAAATGGG - Intergenic
919612793 1:199766801-199766823 TTTTACAAATTGAAGATCTGTGG + Intergenic
920024463 1:202983252-202983274 TTTTACAAATTGAAGGTCTGTGG - Intergenic
920906217 1:210172285-210172307 TTTTGCATATTGGAGATCAAAGG - Intergenic
921091067 1:211843736-211843758 TTTTACAAATTGAAGATTTGTGG - Intergenic
921225976 1:213019587-213019609 TTTTGCAAATTGAAGATTTGTGG + Intergenic
921233537 1:213098829-213098851 TTTTACAAATTGAAGATTTGTGG - Intronic
921700206 1:218260633-218260655 TCTTGTCAAATAAAGATCAGCGG - Intergenic
922239652 1:223747323-223747345 TTTTGCCAGTTGATTTTCAGCGG - Intronic
922389566 1:225126260-225126282 TTTTTCAAATTGAAGATTTGTGG - Intronic
922463229 1:225828806-225828828 CTTTGCCACTTGAAGATGGGTGG + Exonic
922558983 1:226554082-226554104 TTTGGCCAATTGAATGTGAGTGG + Intronic
923221082 1:231893740-231893762 ATTTGCCAATGGAACACCAGTGG - Intronic
923396516 1:233570730-233570752 TTTTGCAAATTGAAGGTTTGTGG + Intergenic
923936485 1:238766021-238766043 TTTTGCAAATTGAAGGTTTGTGG - Intergenic
924040243 1:239977624-239977646 TCTTGCCAATGGAAGAGGAGTGG + Intergenic
924124465 1:240835903-240835925 TTTTGCCTTTTCCAGATCAGTGG + Intronic
924258839 1:242209388-242209410 TTTTACAAATTGAAGATCTGTGG + Intronic
924724226 1:246653329-246653351 TCTTGCCAAGTGAAGATGGGAGG + Intronic
1064460282 10:15528521-15528543 TTTTGGCAATTCAATAACAGGGG + Intronic
1065561152 10:26965026-26965048 TTTTGCCAATTGAAAAGCTTGGG + Intergenic
1066057180 10:31692957-31692979 TTTTGCAAATTGAAGATTTGTGG - Intergenic
1067969162 10:50949864-50949886 TTTTGCCAATTCTAGTCCAGTGG - Intergenic
1068047894 10:51910718-51910740 TTTTGCCAAGCGAAGATGGGTGG + Intronic
1068609868 10:59047304-59047326 TCTGGGCAATAGAAGATCAGTGG - Intergenic
1069087160 10:64154418-64154440 TTTTACAAATTGAAGATCTATGG - Intergenic
1070172428 10:73942712-73942734 TCTTGCAAACTGAAGAGCAGTGG + Intergenic
1071871852 10:89804319-89804341 TTTTACAAATTGAAGATTTGTGG - Intergenic
1074033192 10:109709821-109709843 TTTTACAAATTGAAGATTTGTGG - Intergenic
1074060316 10:109959530-109959552 TTTTGCAAATAGAAGAACATAGG - Intergenic
1074210682 10:111331268-111331290 TTTTGCAAATTGAAGGTTTGTGG + Intergenic
1074371828 10:112906652-112906674 CTTAGCCAATTGAAGAACCGAGG + Intergenic
1075010093 10:118860368-118860390 TTTTACAAATTGAAGATTTGTGG + Intergenic
1075180357 10:120205470-120205492 TTTTACAAATTGAAGATTTGAGG - Intergenic
1075625439 10:123960877-123960899 CTTTGCCAACTGAAGATCTTAGG + Intergenic
1076742500 10:132493698-132493720 TATTGCCAAATAAAGCTCAGAGG + Intergenic
1077452325 11:2655836-2655858 TTTTTCCAATTCAAGAGGAGAGG - Intronic
1078995895 11:16699036-16699058 TTTTGCAAATTGAAGGTTTGTGG - Intronic
1079110120 11:17600667-17600689 CTTTACCAATTGAAGGTCTGGGG - Intronic
1080064427 11:27993953-27993975 TTTTACAAATTGAAGACCTGTGG + Intergenic
1081233381 11:40615062-40615084 TTTTACAAATTGAAGGTCTGTGG - Intronic
1081338575 11:41899580-41899602 TTTAGCCAATGGAATATGAGAGG + Intergenic
1082091515 11:48094209-48094231 TTTAGCAAATTAAATATCAGGGG - Intronic
1083817678 11:65145818-65145840 TTATACAAATTGAAGAGCAGGGG - Intergenic
1084398238 11:68928939-68928961 TTTTGCCAATTGAAGATCAGAGG + Intronic
1084467713 11:69335955-69335977 TTTGGTCAATGGAAGATGAGAGG + Intronic
1086326299 11:85703839-85703861 TTTTGCCACTTTCAGAACAGTGG - Intronic
1086388350 11:86333844-86333866 TTTTGCAAAATGTAGATCAGAGG + Intronic
1087600231 11:100305123-100305145 TTATGCCAATTTAAAAACAGAGG + Intronic
1088466298 11:110143235-110143257 ATTTTCCTATTGAAGATGAGAGG + Intronic
1089063447 11:115644626-115644648 TTCATCCCATTGAAGATCAGGGG + Intergenic
1090307438 11:125703423-125703445 TTTTGCAATCTGCAGATCAGGGG + Intergenic
1091156303 11:133377415-133377437 TTTTGCCGATTGAAGATACCAGG + Intronic
1092824020 12:12380270-12380292 TTTTACAAATTGAAGATTTGTGG - Intronic
1092966695 12:13650585-13650607 ATTTGCCAATTGATGTTCATGGG - Intronic
1092972326 12:13708571-13708593 TTTTGGCATTTGAAGAGGAGAGG + Intronic
1093423746 12:19004255-19004277 TTTTACCAAGAGAAGATCAGAGG + Intergenic
1093958409 12:25248689-25248711 TCTTACCAAATGAAGATCATGGG + Intronic
1094205330 12:27833596-27833618 TTTTTCAAATTGAACATCTGTGG + Intergenic
1095329396 12:40939702-40939724 TTTAGAAAATTGAAGCTCAGAGG + Intronic
1095559106 12:43544563-43544585 TTTTGCCAAGAGAAGATCAGGGG + Intronic
1099158403 12:79208839-79208861 TTTTGCAAATTGAATATAACTGG - Intronic
1101446501 12:104740571-104740593 TTTTGCCATCTGAAAATCAGAGG + Intronic
1103067408 12:117911260-117911282 TTTGGCCAATGGAATATCAGAGG + Intronic
1105281768 13:18967917-18967939 TTTTACAAATTGAAGATCTGTGG - Intergenic
1105288741 13:19031451-19031473 TTTTACAAATTGAAGATTTGTGG - Intergenic
1107068718 13:36245796-36245818 TTTTACAAATTGAAGATTTGTGG + Intronic
1107143698 13:37033831-37033853 TTTTACATATTGAAGATCTGTGG + Intronic
1109061530 13:57628142-57628164 TTTTGGAAGCTGAAGATCAGAGG - Intergenic
1109101379 13:58188062-58188084 TTTTGACAAGTGGAGTTCAGAGG + Intergenic
1109810010 13:67500244-67500266 TTTTACAAATTGAAGATTTGTGG + Intergenic
1109886703 13:68553943-68553965 TTTTCTCAATTGCATATCAGAGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110735503 13:78931339-78931361 TTTTACAAATTGAAGATTTGTGG + Intergenic
1110786014 13:79527031-79527053 TTTGGCTATTTGAAGATCACTGG + Intronic
1111326447 13:86703045-86703067 TTTTACAAATTGAAGATTTGTGG + Intergenic
1111401697 13:87745674-87745696 CTTTACAAATTGAAGATCTGTGG + Intergenic
1112608040 13:100927304-100927326 TTTTGCCATGTGAAGATCTGGGG + Intergenic
1113219596 13:108084903-108084925 TTTCTCCAATTCAAGATCATGGG - Intergenic
1114450943 14:22824985-22825007 CTTTGCCAGTTGAAGTCCAGAGG + Intronic
1115627946 14:35213940-35213962 TTTTACAAATTGAAGATTGGTGG - Intronic
1120318725 14:82931368-82931390 TTTTGCAAATTGAAGGTCTATGG - Intergenic
1121018806 14:90566393-90566415 TTTTACTAATTGAAGATTTGTGG - Intronic
1121679145 14:95778235-95778257 GTTTGCCAATTTAAGATCTTGGG - Intergenic
1125105727 15:35968731-35968753 TTTCACCACTTGAAGTTCAGAGG + Intergenic
1125367521 15:38933856-38933878 TTTTGCAAATTGAAGATTTGTGG - Intergenic
1125988531 15:44080890-44080912 ATTTGCAAATGGAAGGTCAGAGG + Intronic
1126822823 15:52521663-52521685 TTTTGCCAATTGTAGAACTTAGG - Intronic
1127585898 15:60377676-60377698 TTTTACAAATTGAAGATTTGTGG - Intronic
1128297496 15:66536743-66536765 TTTTCCCCATTATAGATCAGTGG + Intronic
1131444393 15:92484971-92484993 TTTAGCCAATCCAAGAACAGTGG - Intronic
1131872723 15:96778303-96778325 TGTTCCCAATTGAACAGCAGAGG - Intergenic
1132174970 15:99705892-99705914 TTTTGAAAATCAAAGATCAGAGG - Intronic
1134794529 16:17022977-17022999 TTTTGCCAATGGAGAAACAGAGG + Intergenic
1135234241 16:20741089-20741111 TTTTGTAAATTGTAGATAAGGGG - Intronic
1137224423 16:46489680-46489702 TTATCCCAAGTGAAGCTCAGGGG + Intergenic
1138033802 16:53581974-53581996 TTTGGCCAATGAAATATCAGTGG + Intergenic
1138696381 16:58817319-58817341 ATTTGCCAATTAATGAGCAGTGG - Intergenic
1138836000 16:60435314-60435336 TTTTACAAATTGAAGATTTGTGG + Intergenic
1140248766 16:73275802-73275824 TTTTACAAATTGAAGATTTGTGG - Intergenic
1141304415 16:82847931-82847953 TTTTACAAATTGAAGATTTGTGG + Intronic
1141312233 16:82925571-82925593 TTGTGGCAGATGAAGATCAGGGG + Intronic
1141337397 16:83169533-83169555 TTTTGCCATTTAAAAAACAGTGG + Intronic
1141481299 16:84308535-84308557 TTTGGCCAATTGAAGCTGATGGG + Intronic
1141903759 16:87009298-87009320 TTGTGCCAGTTTAAGTTCAGTGG + Intergenic
1144537644 17:16106597-16106619 TCTTGCCAATTGAAGAACGAAGG - Intronic
1145191596 17:20845026-20845048 TTTTCCCATTTGGAGATGAGTGG + Intronic
1145401803 17:22545013-22545035 TTTTCCCATTTGGAGATGAGTGG + Intergenic
1145717591 17:27036956-27036978 TTTTACAAATTGAAGATTCGTGG - Intergenic
1147552573 17:41454644-41454666 TTTTGGGTATTGAAGGTCAGTGG - Intergenic
1148947358 17:51275404-51275426 CTGTGCCAATTGAAGAACTGTGG + Intronic
1149972041 17:61228470-61228492 TTTTACAAATTGAAGATTTGTGG + Intronic
1150961371 17:69915920-69915942 TTTTACCAATTGAAAATAATTGG + Intergenic
1151922001 17:77163969-77163991 TTTTGCAAATTGCGGTTCAGTGG - Intronic
1153362529 18:4213624-4213646 TGGTACCCATTGAAGATCAGGGG + Intronic
1153859655 18:9188609-9188631 TTTTACAAATTGAAGGTTAGTGG + Intronic
1153883896 18:9446229-9446251 TTTTGCAAATTGAAGGTTTGCGG + Intergenic
1154470990 18:14701176-14701198 TTTTACAAATTGAAGATTTGTGG + Intergenic
1155306097 18:24480083-24480105 TTTTCCCAGTTGAACCTCAGGGG + Intergenic
1156131019 18:33974739-33974761 TTTTGCAAATTTAAGTTTAGAGG - Intronic
1156361636 18:36389005-36389027 TCTTGCCAAATGCAGATGAGCGG + Intronic
1156813614 18:41281973-41281995 TTGTGCTAATAGAAGAGCAGAGG - Intergenic
1159198834 18:65156525-65156547 TTTTACAAATTGAAGATTTGCGG + Intergenic
1159466797 18:68794360-68794382 TTTTGCCAATGAAACATAAGTGG - Intronic
1159700549 18:71621377-71621399 TTTTACCAACTGAAGATTTGTGG - Intergenic
1159995412 18:74960052-74960074 TTTGTATAATTGAAGATCAGTGG + Intronic
1160603007 18:80028705-80028727 TTTTGCCAATTGACAACCACGGG - Intronic
1164047589 19:21555797-21555819 TTTTGCAATCTGCAGATCAGGGG - Intronic
1164925167 19:32124657-32124679 TTTTGACAAAGGAAAATCAGTGG - Intergenic
1165124998 19:33587909-33587931 TTTTACAAATTGAAGATTTGTGG + Intergenic
1166459930 19:42978164-42978186 TATTGACAATTGAAGCTCTGGGG - Intronic
1166477256 19:43138220-43138242 TATTGACAATTGAAGCTCTGGGG - Intronic
924969777 2:115301-115323 ATTTGCCAACTGAAGATGTGTGG + Intergenic
925360101 2:3272815-3272837 TTTTGCAAATTGAAGGTTTGCGG - Intronic
926469805 2:13239800-13239822 TTTTACAAATTGAAGTTCTGTGG - Intergenic
927657294 2:24960060-24960082 TTTTACAAAGTGAAGATCTGTGG + Intronic
929352264 2:40971545-40971567 TTTTGTCCTTTGGAGATCAGAGG + Intergenic
930135367 2:47898046-47898068 TTTTAACAAATGAAGATCATGGG - Intronic
931407951 2:61999115-61999137 TTTTACAAATTGAAGGTCTGTGG - Intronic
933036606 2:77407515-77407537 TTTTGGCAGTTGAAGGTCAATGG + Intronic
934160875 2:89248542-89248564 TTTTACCAATTGAAGGTTTGTGG + Intergenic
934206401 2:89933891-89933913 TTTTACCAATTGAAGGTTTGTGG - Intergenic
936005350 2:108882314-108882336 TTTTACAAATTGAAGATTTGTGG - Intronic
937099328 2:119256638-119256660 TTTTGCCACTGCAAGAGCAGGGG + Intronic
937953109 2:127403381-127403403 TTTCTCCAATTGAAGAACAGTGG - Intergenic
938151766 2:128893075-128893097 TTTTACAAATTGAAGATTTGTGG - Intergenic
939035583 2:137127184-137127206 TTTTACAAATTGAAGGTCTGTGG - Intronic
940838557 2:158552924-158552946 TTTTACAAATTGAAGGTCTGTGG - Intronic
941140170 2:161770357-161770379 TTTTGCCAATTTAGAATGAGTGG - Intronic
942054991 2:172173779-172173801 TTTTGCCAATTGACCACCAAAGG + Intergenic
944130392 2:196341321-196341343 TATTGCCAACTGAACTTCAGGGG - Intronic
944956592 2:204819178-204819200 TTTTGCAAATTGAAGGTTTGCGG + Intronic
946167648 2:217875041-217875063 TTTGGCCAATTAAACATGAGCGG + Intronic
948107124 2:235423399-235423421 TTTTACAAATTGAAGATTTGTGG + Intergenic
948719049 2:239884720-239884742 TTATGCAAAATGAAGATCAAAGG + Intergenic
1169436302 20:5594802-5594824 TTTTACAAATTGAAGGTCTGTGG + Intronic
1169879815 20:10334549-10334571 ATTAACAAATTGAAGATCAGGGG + Intergenic
1169997849 20:11578460-11578482 TTTGGCCAATGGAACATTAGTGG - Intergenic
1170121429 20:12916751-12916773 TTTTGCCAATTGGAGATGACTGG - Intergenic
1170247088 20:14233304-14233326 TTTTACAAATTGAAGGTCTGTGG - Intronic
1172559964 20:35878591-35878613 TTATACAAATTGAAGAGCAGGGG + Intronic
1173152315 20:40578130-40578152 TATTGCCATTTGCAGATCTGGGG + Intergenic
1174651324 20:52128309-52128331 TTTGGCCAATGGAATATCAGTGG - Intronic
1176262225 20:64187908-64187930 TTTTGCCCAGAGAAGCTCAGCGG + Intronic
1177391321 21:20476631-20476653 TTTTACAAATTGAAGATTTGAGG + Intergenic
1177535178 21:22417156-22417178 TTTTACAAATTGAACATGAGTGG + Intergenic
1178236394 21:30847046-30847068 TTTCACCAATTAAAGATCAATGG - Intergenic
1179421988 21:41243718-41243740 TTTTGCCCTATGAAGATAAGTGG - Intronic
949733995 3:7149391-7149413 TTTCTTCAATTGAACATCAGAGG - Intronic
951983162 3:28587853-28587875 TTTTTCTAATTTAAGTTCAGGGG - Intergenic
952003689 3:28816098-28816120 TTTTACAAATTGAAGATTTGTGG - Intergenic
952106286 3:30073445-30073467 TTTTGCCTTTTGAAGATCAAAGG - Intergenic
953120785 3:40039495-40039517 TCTTGCAACATGAAGATCAGTGG + Intronic
956755970 3:72386977-72386999 ATTTTACAATTGAAGTTCAGTGG - Intronic
958096034 3:88946086-88946108 TTTTACAAATTGAAGGTCTGTGG + Intergenic
959136586 3:102430192-102430214 TTTTGACATTTGAGGATCTGTGG + Intronic
959546319 3:107600914-107600936 TTTTACAAATTGAAGATCTGTGG + Intronic
959596871 3:108138176-108138198 TTTTACAAATTGAAGATTTGTGG + Intergenic
959791405 3:110366613-110366635 TGTTGTCTGTTGAAGATCAGAGG + Intergenic
959793708 3:110396233-110396255 TTTTGCAAATTGATGATTTGTGG - Intergenic
960457929 3:117896502-117896524 TTTTACAAATTGAAGGTCTGTGG + Intergenic
960505184 3:118484896-118484918 TTTTACAAATTGAAGATTTGTGG - Intergenic
962029658 3:131586475-131586497 TTTTGCCAACTGAAGGGCAAGGG + Intronic
964061564 3:152530761-152530783 TTTTACAAATTGAAGGTCAGTGG - Intergenic
964439929 3:156697584-156697606 TTTTACAAATTGAAGGTCTGTGG + Intronic
964734374 3:159901180-159901202 TTTTACCAATGGAATGTCAGTGG + Intergenic
965758156 3:172046068-172046090 GGGTGCCAGTTGAAGATCAGGGG + Intronic
966850668 3:184163290-184163312 TTTTTCCAATTAGGGATCAGAGG + Intronic
966925404 3:184641401-184641423 ATCTGCAAATTGAAGACCAGTGG + Intronic
967519470 3:190412990-190413012 TTTTAACAAGTCAAGATCAGTGG - Intergenic
967628561 3:191715208-191715230 TTTTTCCAATAAAAGATAAGAGG - Intergenic
967725016 3:192853739-192853761 TTTTACAAATTGAAGGTCTGTGG + Intronic
967754286 3:193151095-193151117 GTCTGCATATTGAAGATCAGTGG - Intergenic
967763400 3:193250854-193250876 TTTTTCCAATTGGAGATTAAAGG + Intronic
968270343 3:197398743-197398765 TTTAGCCCACTGGAGATCAGAGG - Intergenic
969631082 4:8337203-8337225 TTTTACAAATTGAAGGTCTGTGG + Intergenic
970298554 4:14657965-14657987 TTTTGCAATTTGGAGGTCAGTGG + Intergenic
970537696 4:17045990-17046012 TTCTTCCAAGTGAAGATCGGTGG - Intergenic
970899400 4:21141267-21141289 TTTTACCAATTGAAGATTTGTGG - Intronic
972922339 4:43959531-43959553 TTTTGCCAACTGGAGATCCTGGG + Intergenic
974346491 4:60689048-60689070 TTTTACAAATTGAAGATTTGTGG + Intergenic
974423350 4:61707355-61707377 TTTTGCAAATTGAAGGTTTGTGG - Intronic
976307420 4:83574688-83574710 TTTTACCAATTTAAGAACTGTGG + Intronic
978676971 4:111330150-111330172 TTTTACAAATTGAAGATTTGTGG + Intergenic
979894436 4:126141618-126141640 TTTTGCCAAGTAAATAACAGTGG + Intergenic
979911381 4:126370900-126370922 TTTTGAAAATTGTATATCAGTGG + Intergenic
980393855 4:132182482-132182504 TTTTGCAAATTGAAGGTTTGTGG - Intergenic
980846831 4:138333963-138333985 TTCTGCCAACTGAAGCTGAGTGG + Intergenic
981151888 4:141388470-141388492 TTTTGACTTTTGAAGATCAGTGG + Intergenic
981220831 4:142232273-142232295 TTTTACAAATTGAAGATTGGTGG + Intronic
981654883 4:147101853-147101875 CTTGGCCAATTTAAGGTCAGTGG - Intergenic
983536359 4:168861471-168861493 TTTTGCATTTTGAAGAGCAGAGG + Intronic
984038560 4:174700258-174700280 TTTTACAAATTGAAGATTTGTGG + Intronic
984138378 4:175970910-175970932 TTTTCCCAACTGAAGAACACAGG + Intronic
984975117 4:185223367-185223389 TTTTGCTGATTGCACATCAGTGG + Intronic
985864667 5:2505058-2505080 TTTGCCCAAGTGAAAATCAGAGG - Intergenic
986520167 5:8606887-8606909 TTTGGCCATTTGAAGGTCATGGG + Intergenic
987368049 5:17167599-17167621 TTTGGCCAATTAAACCTCAGGGG + Intronic
987978057 5:25041873-25041895 TTTTTCAAATTGAAGATTTGTGG + Intergenic
988102138 5:26693858-26693880 TTTTGCAAATTGAAGATTTGTGG - Intergenic
988373669 5:30405451-30405473 TTTAGCAACTTGAAGATCACTGG + Intergenic
988438672 5:31207366-31207388 TTTGGCCAGGTGAAGATGAGTGG - Intronic
989346365 5:40434778-40434800 ATTTTCCACTTGAAGAACAGAGG - Intergenic
990003041 5:50917528-50917550 TTTTACAAATTGAAGATTTGTGG - Intergenic
990159435 5:52921334-52921356 TTTTGAAAATTGTAGTTCAGGGG + Intronic
991651402 5:68858678-68858700 TTTTCCAAATTGAAGATTTGTGG - Intergenic
993483700 5:88455515-88455537 TTTTGCCAATAAAAGGTCATTGG + Intergenic
995099978 5:108288410-108288432 TTTTACAAATTGAAGATTTGTGG - Intronic
995446038 5:112245046-112245068 TTTTACAAATTGAAGATTTGTGG - Intronic
995600982 5:113795796-113795818 TTTTGCAAATTGAAGATTGGTGG - Intergenic
996722357 5:126642265-126642287 TTTTACAAATCGAAGATCTGTGG - Intergenic
996807465 5:127472905-127472927 TTTATCCAATTGAAGGTCTGTGG - Intergenic
998176744 5:139905843-139905865 TTTTGGAAACTGAAGAGCAGGGG - Intronic
998831478 5:146164196-146164218 TTTTTACAATTGAAGATTTGTGG - Intronic
999357399 5:150948349-150948371 TTTTGCAAATTGAAGGCCTGAGG - Intergenic
999882664 5:155883775-155883797 TTTTGCAAATTGAAGGTTTGTGG - Intronic
1000312616 5:160059922-160059944 TTTTACAAATTGAAGATGTGTGG - Intronic
1001628838 5:173159699-173159721 ATTTGCCAATTGAAGAGCCTTGG - Intronic
1001811627 5:174633060-174633082 TTATACAAATTGAAGAGCAGGGG + Intergenic
1002167257 5:177355933-177355955 TCTTGCCAATTGAAAATGTGTGG - Intergenic
1003077439 6:2995470-2995492 TTTTACAAATTGAAGGTCTGTGG - Intronic
1003187759 6:3848187-3848209 TTTTACAAATTGAAGATTTGTGG - Intergenic
1003397827 6:5768429-5768451 TATTGCCAATTGAAGATGGATGG - Intronic
1003543477 6:7038645-7038667 TTTGGCCAATTGATGGCCAGTGG + Intergenic
1003728555 6:8793855-8793877 TTTTGCAAATAGAGGAACAGAGG - Intergenic
1003925338 6:10872280-10872302 TTTTGGCAATGGAAGTTCAAAGG + Intronic
1004550273 6:16640069-16640091 TTTTTCAAATTGAAGTTCTGTGG + Intronic
1004773429 6:18813088-18813110 TATTACCAGTTGAAAATCAGTGG - Intergenic
1005402259 6:25447163-25447185 TTTTGCCAATTGAAGCTTTGTGG - Intronic
1006140082 6:31923272-31923294 TTTTGCCAATGGAATATGAATGG + Intronic
1006326727 6:33359972-33359994 TTTTGCCCATTGTAGATAAGTGG + Intergenic
1006643530 6:35500765-35500787 TTTTGCCAATTACAGTGCAGTGG - Intronic
1007280290 6:40707288-40707310 TTTTGCCAAGAGAGAATCAGGGG + Intergenic
1007379509 6:41478682-41478704 TTTTACAAATTGAAGGTCCGTGG + Intergenic
1009733689 6:67646159-67646181 TTTTACAAATTGAAGATTTGTGG + Intergenic
1010050042 6:71492691-71492713 TTTTACAAATTGAAGATTTGTGG + Intergenic
1011095947 6:83662902-83662924 TTTTGCAAATTGAAGATTTGTGG + Intronic
1011115650 6:83888349-83888371 TTTTACAAATTGAAGATTCGTGG + Intronic
1011798616 6:90983848-90983870 TTGTGCCAGTTAAAGATCACTGG - Intergenic
1012024116 6:93966530-93966552 TTTTTCCAAGTGTAGATAAGGGG - Intergenic
1012918284 6:105194679-105194701 TTTTGCCAACTCTAGATCATAGG - Intergenic
1014354299 6:120385365-120385387 TTTTGCAAATTGAAGATTTGTGG - Intergenic
1015640695 6:135328281-135328303 TTTTGCCAACTGAAGGTTTGTGG + Intronic
1015667075 6:135644000-135644022 TTTTGCAAATAGAAAATCAATGG + Intergenic
1015969458 6:138729896-138729918 TTTGGCCAATGGCAGATGAGTGG - Intergenic
1016645482 6:146402512-146402534 TTTTGCCAACTGAAGCAAAGGGG + Intronic
1017357933 6:153531954-153531976 TTTTTCCAATTCATGATCATGGG + Intergenic
1017610591 6:156182338-156182360 TTTTGTCAATTAATAATCAGTGG + Intergenic
1019821899 7:3250277-3250299 TTTTACAAATTGAAGATTTGTGG + Intergenic
1020757947 7:12227695-12227717 ATTTGCCAATTAAAGATCATAGG + Intronic
1020833314 7:13118182-13118204 TTTTACAAATTGAAGATTTGTGG + Intergenic
1020901964 7:14015085-14015107 TGTTTCCAAGTGTAGATCAGAGG - Intergenic
1021015556 7:15526744-15526766 TTTTGCAAATTGAAGGTTTGTGG + Intronic
1021350082 7:19581631-19581653 TTGTGTCAATGGAAGATGAGTGG + Intergenic
1022493568 7:30838859-30838881 TCTTGCCTGTGGAAGATCAGAGG + Intronic
1022958827 7:35405659-35405681 TTTTACAAATTGAAGGTCTGTGG + Intergenic
1029049862 7:97674381-97674403 TTTTACAAATTGAAGATCTGTGG + Intergenic
1029163746 7:98571370-98571392 TTTAGCCAATGGAAGGTTAGCGG + Intergenic
1030038322 7:105427346-105427368 TTTTGCAAATTGAAGGTTTGTGG - Intergenic
1030992946 7:116323256-116323278 TTTTACAAATTGAAGGTCTGTGG + Intronic
1031851585 7:126870859-126870881 TTTTACAAATTGAAGAGCTGTGG - Intronic
1033139792 7:138815887-138815909 TTTTACAAATTGAAGATTTGTGG + Intronic
1033920378 7:146384303-146384325 TATTGACATATGAAGATCAGTGG + Intronic
1034361616 7:150504527-150504549 TTTTACAAATTGAAGATTTGTGG + Intergenic
1034981100 7:155477317-155477339 TTTTGCAAATTGAAGGTTTGTGG + Intronic
1036388372 8:8302571-8302593 TTTTACCAATTGAAGATTTGTGG - Intergenic
1040416448 8:47200059-47200081 TTCTGCCAATTCAATAACAGAGG - Intergenic
1040701956 8:50076046-50076068 TTTTACAAATTGAAGATTTGTGG - Intronic
1043044376 8:75302428-75302450 TTGTACAAATTGAAGAGCAGAGG + Intergenic
1043174984 8:77013877-77013899 TTATACAAATTGAAGAGCAGGGG - Intergenic
1043862323 8:85334420-85334442 GTCTGCCATTTGAAGATCATGGG - Intronic
1044381144 8:91535338-91535360 TCTTGCCAATTGAATATTAATGG - Intergenic
1046126425 8:109914515-109914537 GTTTGGAAACTGAAGATCAGAGG + Intergenic
1048569402 8:135639136-135639158 TTTAGCAACTTGAAGTTCAGTGG + Intronic
1048716687 8:137278752-137278774 TTTTGCTCAGTGAAGTTCAGTGG + Intergenic
1048940101 8:139393005-139393027 TTTTGGCAGTTGAATTTCAGTGG - Intergenic
1049863220 8:144915196-144915218 TTCTGCCTATTGAAGAGTAGAGG - Intergenic
1051234154 9:14980721-14980743 TTTTGACAATGGCAGATCACAGG - Intergenic
1051254113 9:15194577-15194599 TTTTACAAATTGAAGATTTGTGG + Intronic
1051473472 9:17475975-17475997 TTTTACAAATTGAAGATTTGTGG + Intronic
1052119290 9:24690737-24690759 TTTTGTCCATTGAAGATCATAGG + Intergenic
1052631608 9:31048391-31048413 ATTTGAGAATTGGAGATCAGAGG - Intergenic
1053296593 9:36919154-36919176 TTTTTCCACTTGTAGATCACAGG - Intronic
1054751736 9:68914413-68914435 TTTTGCCAATTGAAAATTCCTGG + Intronic
1055107920 9:72531783-72531805 ATTTTCCAATTGAAGATAGGTGG - Intronic
1055147741 9:72956838-72956860 TTTTTCCAATTGAAGAAGAATGG - Intronic
1055232334 9:74080679-74080701 TTTTACAAATTGAAGGTCTGTGG - Intergenic
1055402427 9:75938579-75938601 TTTTACAAATTGAAGATTTGTGG - Intronic
1055807420 9:80112159-80112181 TTTTACCAATTGAAAATTTGTGG - Intergenic
1055873993 9:80920819-80920841 TTTTGCAAATTGAAGGTTTGTGG - Intergenic
1056565195 9:87765693-87765715 TTTTTCTATTGGAAGATCAGAGG + Intergenic
1056565496 9:87769381-87769403 TTTTTCCACTTTAAGCTCAGGGG + Intergenic
1059558371 9:115306020-115306042 TTTTACCTGTTGAAGATAAGGGG - Intronic
1186187313 X:7033820-7033842 TATTGACAATTGAAGCTCTGGGG - Intergenic
1186985799 X:15012051-15012073 TTGTGGCAAATGAAGCTCAGAGG - Intergenic
1188060576 X:25596084-25596106 TTTTGATAATTGAAGATTATAGG + Intergenic
1188385124 X:29547099-29547121 TTTTGAAAATTGAAAATCACAGG + Intronic
1188432636 X:30122306-30122328 TTTTACAAATTGAAGATTCGTGG + Intergenic
1188549704 X:31349712-31349734 TTTTGCCAATCCAATATAAGTGG + Intronic
1189828308 X:44943432-44943454 TTTTGCAAATTGAAGGTTTGTGG - Intronic
1189951599 X:46237402-46237424 TTTTACAAATTGAAGGTCTGTGG + Intergenic
1190484714 X:50913024-50913046 TGGTTCCAATTGAAGAACAGAGG + Intronic
1192348298 X:70331621-70331643 TTTTACAAATTGAAGATCTGTGG - Intronic
1192388599 X:70700292-70700314 TTTTACAAATTGAAGATGTGTGG + Intronic
1192720333 X:73689492-73689514 TTTTACAAATTGAAGATTTGTGG - Intergenic
1192828902 X:74729644-74729666 TTTCTCCAAATGAAGATCAAAGG + Intergenic
1192980868 X:76339717-76339739 TTTTGCAAATTGAAGGTTTGTGG + Intergenic
1194326348 X:92522584-92522606 TTTTACATATTGAAGATCTGTGG - Intronic
1194590448 X:95794186-95794208 TTTTTCAAATTTAAGTTCAGGGG + Intergenic
1195593341 X:106657962-106657984 TTTTGCAAATTGAAGGTCTGTGG - Intronic
1195620433 X:106949096-106949118 TTATGCAATTTGAAGAACAGTGG - Intronic
1195987943 X:110651633-110651655 TTTTACAAATTGAAGATCTGTGG - Intergenic
1196260384 X:113572444-113572466 TTTTACAAATTGAAGATTTGTGG - Intergenic
1198274325 X:135087166-135087188 TTTTGCCCATGGAAGTGCAGAGG - Intergenic
1198886068 X:141339027-141339049 TTTTGCCCATTAAAAATGAGTGG - Intergenic
1198970693 X:142275907-142275929 TTTTACAAATTGAAGATTTGTGG - Intergenic
1200371818 X:155734620-155734642 TTTTTCAAATTGAAGATTTGTGG - Intergenic
1200635070 Y:5641786-5641808 TTTTACATATTGAAGATCTGTGG - Intronic