ID: 1084399738

View in Genome Browser
Species Human (GRCh38)
Location 11:68936719-68936741
Sequence TCGTGGGAATTGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084399738_1084399750 14 Left 1084399738 11:68936719-68936741 CCTCCTTCCCTCAATTCCCACGA 0: 1
1: 1
2: 2
3: 22
4: 279
Right 1084399750 11:68936756-68936778 ACCAAATAGCCGAGGAGCACGGG 0: 1
1: 0
2: 0
3: 6
4: 81
1084399738_1084399747 6 Left 1084399738 11:68936719-68936741 CCTCCTTCCCTCAATTCCCACGA 0: 1
1: 1
2: 2
3: 22
4: 279
Right 1084399747 11:68936748-68936770 GCGGGTCCACCAAATAGCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1084399738_1084399749 13 Left 1084399738 11:68936719-68936741 CCTCCTTCCCTCAATTCCCACGA 0: 1
1: 1
2: 2
3: 22
4: 279
Right 1084399749 11:68936755-68936777 CACCAAATAGCCGAGGAGCACGG 0: 1
1: 0
2: 0
3: 12
4: 90
1084399738_1084399752 20 Left 1084399738 11:68936719-68936741 CCTCCTTCCCTCAATTCCCACGA 0: 1
1: 1
2: 2
3: 22
4: 279
Right 1084399752 11:68936762-68936784 TAGCCGAGGAGCACGGGCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084399738 Original CRISPR TCGTGGGAATTGAGGGAAGG AGG (reversed) Exonic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
903136731 1:21314257-21314279 GCGTGGGAGTTCTGGGAAGGGGG + Intronic
903951902 1:27000522-27000544 TCCTGATAATGGAGGGAAGGGGG + Exonic
904843261 1:33388120-33388142 TGGTGGGCATTCAGGAAAGGTGG - Intronic
905313278 1:37065295-37065317 TGGTGGAAATTGACTGAAGGGGG - Intergenic
905417156 1:37811916-37811938 GGTTGGGCATTGAGGGAAGGTGG - Exonic
907923507 1:58934599-58934621 TGGGGGGAATGGAAGGAAGGTGG + Intergenic
908186537 1:61657784-61657806 TGGTGGGACTAGAGGGAAAGTGG + Intergenic
908420794 1:63956559-63956581 TAGTGGGAATTAAGGGAATTTGG - Intronic
910448399 1:87322309-87322331 TCATGGTAATTTATGGAAGGGGG - Intergenic
911723802 1:101220238-101220260 TGGGGAGAATTGAGGGAAGCAGG + Intergenic
911829796 1:102536386-102536408 TCATGAGAACAGAGGGAAGGGGG + Intergenic
912437723 1:109673571-109673593 TGGTGGGAAGGGAGGGATGGAGG + Intronic
912588046 1:110784705-110784727 TAGTGGGAATTGAGAGAAACAGG - Intergenic
912688160 1:111783329-111783351 TGGTGGAAATTCAGGGAAGGAGG - Intronic
913047335 1:115085631-115085653 TCGTGGGAAGTTTGGGAAAGGGG - Intronic
914247529 1:145897164-145897186 TCCTGGGACTTCAGGGAAGGGGG - Intronic
914465206 1:147922176-147922198 TGGAGGGGAGTGAGGGAAGGGGG - Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915248111 1:154570237-154570259 TCCTGGGAAATGAGAGAGGGAGG - Exonic
915545383 1:156594072-156594094 TCGTCTGCAGTGAGGGAAGGTGG + Exonic
916115929 1:161485089-161485111 TTCTGGAAATTGAAGGAAGGAGG - Intergenic
916859388 1:168786614-168786636 TTGTGGGAATTGTGGTAAGTTGG + Intergenic
917242013 1:172958793-172958815 TCGTGGAAATTTGGGGGAGGGGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
918209861 1:182340990-182341012 TCCTGGGAATTGGTGGAAAGGGG + Intergenic
919064950 1:192682894-192682916 TGTTCGGAATAGAGGGAAGGGGG - Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
920074628 1:203327322-203327344 TCGTGGGGATTGAGGGACGTGGG - Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921495670 1:215838173-215838195 TCATGTGAAATGAGGGAAGGTGG - Intronic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
1063433440 10:6011296-6011318 TCGTGGGAGTTGAGAGTGGGTGG + Exonic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064266570 10:13830236-13830258 TCCTGCAAATGGAGGGAAGGAGG - Intronic
1065941281 10:30566196-30566218 TTGAGGGAATTGGGGGAAAGTGG - Intergenic
1066302004 10:34105538-34105560 TCATGGGAGTAGAGGGCAGGAGG - Intergenic
1067068476 10:43116559-43116581 ATGTTGGAAATGAGGGAAGGGGG - Intronic
1067901976 10:50251354-50251376 TCTTGGGGAAGGAGGGAAGGAGG - Intergenic
1069232996 10:66035512-66035534 TAGTAGGAATAGAGGGAATGAGG + Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1070394791 10:76002740-76002762 TCCTTGGCATTGAGGCAAGGAGG + Intronic
1072157233 10:92734801-92734823 TCGTGGGAAGTTGGGGCAGGAGG + Intergenic
1072207073 10:93214291-93214313 TCCTGGCAATTCAGGGAAGCAGG + Intergenic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1072800992 10:98392352-98392374 TCGTGGGGATTGAGGGAGCCAGG - Intronic
1073257503 10:102162740-102162762 TCTAGGGTTTTGAGGGAAGGAGG - Exonic
1075152736 10:119949076-119949098 TCGTGCTTATTGAGGGAAGAAGG + Intergenic
1076488894 10:130843213-130843235 TGGTGAGAATTAAGGGAGGGAGG - Intergenic
1076711357 10:132336965-132336987 TCGTGACAAATAAGGGAAGGTGG - Intronic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1080840135 11:35976358-35976380 TGGTGGGAAAGGAGGGTAGGAGG + Intronic
1081660154 11:44883125-44883147 TCTTGGGAGCAGAGGGAAGGTGG - Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083856623 11:65396269-65396291 TGGTGGGAAGTGCAGGAAGGTGG + Intronic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1085037759 11:73309965-73309987 TCTAGGGCATTGAGGGATGGAGG + Exonic
1088208538 11:107424537-107424559 TCCTGGGAAGTGAGGGGAAGAGG - Intronic
1091798550 12:3310687-3310709 TGGTGGTAATAGAAGGAAGGTGG - Intergenic
1095288592 12:40447627-40447649 TTCTGGGAATTGAGGGAGTGAGG + Intronic
1096084578 12:48857226-48857248 TCTTTGGAATTGGGGGGAGGGGG - Exonic
1096790327 12:54040377-54040399 TGGTGGGAAGGGAGGGAGGGAGG - Intronic
1097080189 12:56424716-56424738 TCTTGGGCTTTGGGGGAAGGAGG - Intronic
1097298148 12:57989414-57989436 ATGTGGGGATTGAGGGAAAGAGG + Intergenic
1097899425 12:64858185-64858207 TGGTGGGAATGGAGGGTGGGCGG - Intronic
1099284832 12:80704694-80704716 TTTTGGGAGTTGAGGGCAGGAGG - Intergenic
1100550303 12:95640818-95640840 ACGTGGGAAATGAAGGAAAGGGG - Intergenic
1102664790 12:114562788-114562810 TTGTGGGAAGTTTGGGAAGGAGG + Intergenic
1103110293 12:118271344-118271366 TCTTAGGAATGGAGGGAATGGGG - Intronic
1105424827 13:20285162-20285184 TTCTGGGGATCGAGGGAAGGAGG + Intergenic
1106143113 13:27027442-27027464 TAGTGGGAGCTGAGGGAGGGAGG + Intergenic
1106620666 13:31367754-31367776 TTCTGGGGATTGAGGGGAGGAGG + Intergenic
1108052441 13:46459850-46459872 TCTTGGGATTTGAGGGAGGTTGG - Intergenic
1109447005 13:62454087-62454109 TTGTGGGCATTGAGGGAAAGGGG - Intergenic
1109538832 13:63746251-63746273 TCTTGGGATTTGAGGGAGGTTGG + Intergenic
1109545003 13:63833513-63833535 TCTTGGGATTTGAGGGAGGTTGG - Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1110851060 13:80245462-80245484 TGGTGGGAATTGATGGTGGGGGG - Intergenic
1110944999 13:81402732-81402754 TCATGGGAAGTAAGGAAAGGTGG - Intergenic
1111151531 13:84260273-84260295 TATTGGGAATTCAGGGAAAGGGG - Intergenic
1112452030 13:99521459-99521481 TCGTGAGAAAGCAGGGAAGGTGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113227419 13:108174663-108174685 TTGTGGAAATTGTGGAAAGGAGG + Intergenic
1115568991 14:34649471-34649493 TGGTGGGAATTGGGGAGAGGAGG - Intergenic
1117722266 14:58638775-58638797 TCGCGCGGATTGCGGGAAGGGGG + Intronic
1118243104 14:64080925-64080947 TAATGGGAATTTAGGGCAGGTGG + Intronic
1119382639 14:74239078-74239100 GCATAGGAGTTGAGGGAAGGAGG + Intergenic
1122407521 14:101509140-101509162 CCATGGGAATTGATGGCAGGTGG + Intergenic
1124910927 15:33919781-33919803 TCGTGTTAATTTAGGGAATGAGG - Intronic
1128727999 15:70001870-70001892 TTAGGGGATTTGAGGGAAGGGGG + Intergenic
1130027108 15:80279518-80279540 TCTTGGGAAGTGAGAGAAGAGGG + Intergenic
1130684504 15:86024946-86024968 TTCTGGCAATTGAGTGAAGGTGG + Intergenic
1130995707 15:88902801-88902823 TCTGGGGAATTGAGGGAGGCAGG + Intronic
1132630406 16:914568-914590 TCATGGGAAGGGAGGGAAAGAGG - Intronic
1132630454 16:914762-914784 TCATGGGAAGGGAGGGAGGGAGG - Intronic
1133325176 16:4937571-4937593 TGGTGGCAATTGAGGGAAGGGGG + Intronic
1133716138 16:8451022-8451044 TCATGTGTGTTGAGGGAAGGAGG + Intergenic
1133716379 16:8453368-8453390 TCCTGGGTAATGTGGGAAGGTGG + Intergenic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134596477 16:15500014-15500036 TAGTGGAAATTGAGTGAGGGGGG + Intronic
1135353337 16:21749025-21749047 TCATGGGAATAGTGGGAAGAAGG + Intronic
1135451824 16:22565148-22565170 TCATGGGAATAGTGGGAAGAAGG + Intergenic
1137708591 16:50551222-50551244 TTGGGGGAAGTGAGGGAGGGTGG + Intronic
1139409768 16:66750315-66750337 CCATGGGAATTGGGGGATGGAGG + Intronic
1139423694 16:66865716-66865738 TCATGTGAAATGAGGGAAGATGG - Intronic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141094883 16:81156078-81156100 ACCTGGGAAGGGAGGGAAGGAGG - Intergenic
1141404884 16:83783885-83783907 TCGTGAGAATTTATGGATGGAGG + Intronic
1143018556 17:3904536-3904558 TGGGGGGAAATGGGGGAAGGAGG - Intronic
1144234407 17:13243643-13243665 TAGGTGGAACTGAGGGAAGGTGG - Intergenic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147421630 17:40324767-40324789 TCTTGGGAGTTAGGGGAAGGAGG - Intronic
1148283386 17:46366963-46366985 TAGTGGCACTTGGGGGAAGGTGG - Intergenic
1148305604 17:46584884-46584906 TAGTGGCACTTGGGGGAAGGTGG - Intergenic
1148387719 17:47246872-47246894 TCCAGGGATTGGAGGGAAGGAGG + Intergenic
1149576003 17:57714060-57714082 TTGTTAGAATTCAGGGAAGGGGG + Intergenic
1149682331 17:58514888-58514910 TCGGGGGAACTTAGGGGAGGGGG - Intronic
1151147526 17:72054780-72054802 TCTTGGAGATTGAGGGAGGGGGG + Intergenic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153591063 18:6674546-6674568 TGGTGGGGACTGAAGGAAGGGGG + Intergenic
1154063414 18:11084522-11084544 CCGTGGGAGGTGAGGAAAGGGGG - Intronic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1158131059 18:54153147-54153169 TCGTGGGGATGGAGGAGAGGTGG + Exonic
1158657524 18:59352640-59352662 TCCTGGGAGTTGGGGGAAGAGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1163729771 19:18942051-18942073 TCCTGGCAAGTGTGGGAAGGGGG - Intergenic
1165899891 19:39164416-39164438 GCCTGGGAAGTCAGGGAAGGTGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166072578 19:40395601-40395623 CCGTGGAAATTGAGGAAGGGCGG - Exonic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
925252178 2:2448955-2448977 TCGTGGGAACTAATGGAGGGGGG + Intergenic
927458342 2:23276497-23276519 TCTTGGGACTTAAGGGAGGGTGG + Intergenic
929393451 2:41496811-41496833 TTCTGGAAATTGAAGGAAGGAGG + Intergenic
929981446 2:46683925-46683947 TCAGAGGAATTGAGGGGAGGTGG - Intergenic
930235046 2:48880776-48880798 TCTTGGGAACTGAGTGAAGTTGG + Intergenic
931389961 2:61833054-61833076 TGGTGGGGAATGAGGGAAGGTGG + Intronic
931732460 2:65165386-65165408 TCCTGGTAGTTGGGGGAAGGTGG + Intergenic
932197323 2:69795995-69796017 TTCTGGAAATTGAAGGAAGGAGG - Intronic
932450346 2:71806139-71806161 TCGTTGAAAGTGAGGGAAGAAGG + Intergenic
933628878 2:84633828-84633850 TTGTGGGAATCGGAGGAAGGGGG + Intronic
934522409 2:95027467-95027489 TCCTGGGAAGTGAGGAAGGGAGG - Intronic
934583727 2:95469484-95469506 TCGTGGAAATACAGGGAAGAAGG + Intergenic
934595725 2:95607230-95607252 TCGTGGAAATACAGGGAAGAAGG - Intergenic
936118508 2:109721842-109721864 TGGTGGGAATTGGGGCAAGGTGG - Intergenic
937972106 2:127558885-127558907 TCGGGGAAAGGGAGGGAAGGGGG + Intronic
940032160 2:149274930-149274952 TTGTGGGAATGGACTGAAGGAGG + Intergenic
940860015 2:158761848-158761870 TGGCTGGAAGTGAGGGAAGGGGG - Intergenic
940989853 2:160086126-160086148 TTCTGGAAATTGAAGGAAGGAGG - Intergenic
944940691 2:204622336-204622358 TCGTGGGAGTTGGGAGAAGAGGG - Intronic
945160923 2:206889685-206889707 TCTTGAGAGTGGAGGGAAGGAGG - Intergenic
946666958 2:222060471-222060493 TCATGGGCAGAGAGGGAAGGAGG + Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1168878616 20:1187111-1187133 TTGAAGGAAGTGAGGGAAGGGGG - Intronic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1171035920 20:21712997-21713019 TGGAGGGAATGGAGGGCAGGAGG + Intronic
1175702269 20:61148208-61148230 TGCTGGGAATTGAGAGAAGAGGG + Intergenic
1176653822 21:9572504-9572526 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1177004746 21:15657609-15657631 TGGGGGGAATGGATGGAAGGGGG - Intergenic
1178228760 21:30755902-30755924 TCTTGGGATTTGAGGGAGGTTGG - Intergenic
1178666862 21:34555625-34555647 TGGTGGGAAGTGTGGGAAGGAGG + Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1180258785 21:46651727-46651749 TGGTCGGATTTGAGGGAGGGAGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184344647 22:43905612-43905634 TCGTAGGCACTGAGGGCAGGAGG - Intergenic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
949950421 3:9224530-9224552 TTGTGGCAATTTTGGGAAGGCGG - Intronic
951584211 3:24198555-24198577 TCGTGTAAATTGAGAGAAAGGGG - Intronic
952189060 3:31002727-31002749 TTGTGGGAAGTGAGGGCTGGAGG + Intergenic
952761442 3:36917962-36917984 TAGAGGAAATTGAGGGATGGAGG + Intronic
953453356 3:43022046-43022068 TGGTTAGAATTGAGGGGAGGAGG + Intronic
954437276 3:50502984-50503006 TCGGGGGATTTGGGGGAAGCAGG + Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955163498 3:56488066-56488088 TAGTGGGAATTGAGGCAGGAGGG - Intergenic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956067952 3:65416997-65417019 TTGAGGGAAATGAAGGAAGGTGG + Intronic
957550162 3:81694163-81694185 TGGAAGGAAATGAGGGAAGGGGG + Intronic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
961063045 3:123848978-123849000 TGGTAGGAATTGAGGGCAGATGG + Intronic
961145012 3:124586210-124586232 GGCTGGGAATTGAGGGAAAGGGG + Intronic
962342713 3:134598620-134598642 TCGTGGGAAAGGAGAGAAGGTGG + Intronic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
966742523 3:183247488-183247510 TCTTGGGAATTGAAGTAATGAGG - Intronic
971069625 4:23076830-23076852 TCGTGGGATTTGAGGAATGAGGG - Intergenic
974648652 4:64726516-64726538 TCGTGGAAATTGAGGGCAACTGG + Intergenic
975599363 4:76083233-76083255 GAGTGGAAATTGAGGAAAGGTGG - Intronic
978197695 4:105990356-105990378 TGGTGGGAATCCAGGGAAAGGGG - Intronic
979654533 4:123176837-123176859 TTGTGGGAGGTGGGGGAAGGGGG + Intronic
979828977 4:125276993-125277015 TCTTGGGAACTCAGAGAAGGAGG + Intergenic
982757053 4:159233616-159233638 TCGGGGGAAGTGTGAGAAGGGGG + Intronic
982878452 4:160677291-160677313 TATTTGGAAGTGAGGGAAGGAGG + Intergenic
983327477 4:166275171-166275193 CTGTTGGAATTGAGGGAATGAGG + Intergenic
983855861 4:172643579-172643601 TAGTGGGAATTGTTGGAAGCTGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
985338539 4:188922213-188922235 TGGTGGGAATTGAGGCAAGGAGG - Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
987788549 5:22534347-22534369 TCAGGGGAAGTGTGGGAAGGGGG - Intronic
988013563 5:25523046-25523068 TCCTTGGATTTGAAGGAAGGAGG - Intergenic
989140713 5:38198748-38198770 TTCTGGGAAGTGGGGGAAGGAGG + Intergenic
989188460 5:38646844-38646866 TTTAGGGAATTGAGGGAAGCAGG + Intergenic
990230992 5:53712708-53712730 TCTTGGGAATTCTGGCAAGGTGG - Intergenic
990280599 5:54246663-54246685 TCGCAGGAATAGAGAGAAGGGGG - Intronic
991645385 5:68795814-68795836 AGGTGGGAGGTGAGGGAAGGTGG - Intergenic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
995342347 5:111073430-111073452 TGGTGAGAATTGAGTGAAAGGGG - Intronic
995417260 5:111925132-111925154 TTCTGGAAATTGAAGGAAGGAGG - Intronic
997906540 5:137822774-137822796 TCTAGGAATTTGAGGGAAGGAGG + Intergenic
998025943 5:138816510-138816532 TGGTGGGAATGCAGGGAAAGGGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999152056 5:149432852-149432874 TTCTGGGAATTTGGGGAAGGGGG + Intergenic
1000062384 5:157668954-157668976 TCCTGGGAAGTGAGGAAAGCCGG - Intronic
1002046086 5:176542634-176542656 GGCTGGGAAGTGAGGGAAGGAGG - Exonic
1004472281 6:15940049-15940071 TCTTGGAAATGCAGGGAAGGAGG + Intergenic
1004852634 6:19715822-19715844 TTGTGGGAATTGAAGGATGGGGG + Intergenic
1005631890 6:27716115-27716137 TAGGGGGAATTGAGGGAATGGGG + Intergenic
1005986474 6:30878896-30878918 TCATGGGAACCCAGGGAAGGAGG - Intronic
1006290233 6:33129326-33129348 TCCTGGGACTTAAAGGAAGGGGG + Intergenic
1006301067 6:33193709-33193731 GCCTGAGAATTGAGGGGAGGTGG - Exonic
1007004403 6:38346865-38346887 TGGAGGGAATAGAGGGAATGTGG + Intronic
1007770245 6:44186321-44186343 TGGTGATAATGGAGGGAAGGCGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1010862598 6:80931884-80931906 TCGAGGGAAAGGAGGGGAGGGGG - Intergenic
1011768673 6:90652112-90652134 GCCTGGGAAATTAGGGAAGGGGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017689257 6:156946685-156946707 TTGTTGGAATAGAGGGAGGGAGG + Intronic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019175960 6:170159687-170159709 TCCTGGGGTTTGAGGGAACGAGG - Intergenic
1020356305 7:7279450-7279472 TGGTGGGAATGGAGTGGAGGAGG + Intergenic
1021042326 7:15877524-15877546 TTGTGGAAATAGAGGGAAAGTGG + Intergenic
1021095864 7:16535358-16535380 TCTTGAAAATTCAGGGAAGGTGG + Intronic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1022458298 7:30578924-30578946 TCTTGGTAATTGAGGGAAACTGG - Intergenic
1022482835 7:30755158-30755180 TCCTGGGGATTAAGGGAAGGGGG + Intronic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1024224475 7:47315168-47315190 TTGTGGGAATTAAGGGCAGAAGG - Intronic
1025280166 7:57621170-57621192 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1025304567 7:57844331-57844353 TCCTGGGAAGAGAGGGCAGGAGG - Intergenic
1026046589 7:66909795-66909817 TGGTGGGAATTGGGGAAAGGAGG - Intergenic
1026898924 7:74026828-74026850 TAGTGGGAAGTGAGGGGTGGGGG + Intergenic
1027145828 7:75693766-75693788 TCGGGGGAAGGGAGGGAGGGAGG + Intronic
1029469688 7:100746486-100746508 TGGATGGAATTGAGGGAAGATGG - Intronic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1031524498 7:122807771-122807793 TGGGGGGCATTGGGGGAAGGTGG + Intronic
1032607037 7:133366932-133366954 CCGTGGCAATGGAGTGAAGGAGG + Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033459580 7:141533225-141533247 ACTTGGGGACTGAGGGAAGGTGG + Intergenic
1034009248 7:147509848-147509870 TTCTGGGAATTGAAGGAAAGAGG + Intronic
1034976130 7:155450093-155450115 GCGAGGGACTTGGGGGAAGGGGG + Intergenic
1036075371 8:5493575-5493597 GCGTGTTAATTGATGGAAGGGGG - Intergenic
1036724810 8:11210432-11210454 TCTTGAGAACTGAGGGAAGGCGG + Intergenic
1038103519 8:24407686-24407708 TGGGGGGAATTGTTGGAAGGAGG - Intergenic
1043510156 8:80943162-80943184 TTGTGGGATGTGAGGGAGGGAGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043945306 8:86244470-86244492 TCTGGAGACTTGAGGGAAGGAGG + Intronic
1047072808 8:121365994-121366016 TCGTGGACATAGAGAGAAGGAGG + Intergenic
1047934734 8:129765792-129765814 TCCTGGGGATTTAAGGAAGGAGG + Exonic
1048251141 8:132867762-132867784 TCATGGGAATTGCGGCAGGGTGG + Intronic
1049311258 8:141935054-141935076 TCGTGGCACTTGAGGAAGGGCGG + Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050765001 9:9121666-9121688 TGGTGGGAAGTGTGGGAGGGGGG + Intronic
1051181130 9:14412989-14413011 AGGTGTGATTTGAGGGAAGGAGG - Intergenic
1051605924 9:18917782-18917804 TTCTGGGAATTGAGGTATGGTGG - Intergenic
1051783868 9:20721251-20721273 TGGTGAGAGGTGAGGGAAGGGGG - Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1053182106 9:35981576-35981598 TGGTAGGAAGAGAGGGAAGGAGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053543393 9:38997956-38997978 TTGTGGGAATTCAGAGAATGGGG - Intergenic
1053665598 9:40315212-40315234 TAGTGGGAGTTGGGGGTAGGGGG + Intronic
1053915181 9:42940259-42940281 TAGTGGGAGTTGGGGGTAGGGGG + Intergenic
1054376753 9:64455242-64455264 TAGTGGGAGTTGGGGGTAGGGGG + Intergenic
1054519016 9:66061072-66061094 TAGTGGGAGTTGGGGGTAGGGGG - Intergenic
1054791433 9:69260250-69260272 TGGTGGGAGATTAGGGAAGGAGG - Intergenic
1056726399 9:89122805-89122827 GAGTAGGAATTGTGGGAAGGAGG + Intronic
1057749945 9:97784341-97784363 TAGTGGGAATGGCTGGAAGGCGG - Intergenic
1059579023 9:115523353-115523375 TCCTGGGAATTGACTTAAGGGGG + Intergenic
1059592143 9:115673100-115673122 TGGTGGGAAGTGAGGCGAGGGGG + Intergenic
1060180396 9:121529736-121529758 TCGTGGGAACTCAGGCAAGGAGG + Intergenic
1060413284 9:123413830-123413852 TGGTGTGAATTGAGGGGTGGGGG - Intronic
1061703021 9:132430274-132430296 TCGTGGCATTTGTGGGATGGGGG + Intronic
1061917396 9:133762609-133762631 GCTTGGGAAATGAGGGGAGGTGG - Exonic
1062550702 9:137085037-137085059 GGGTGGGGATTGAGGAAAGGGGG + Intergenic
1203631543 Un_KI270750v1:75956-75978 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189363755 X:40372250-40372272 ACGTGGGAAGTGAGTGCAGGGGG - Intergenic
1189485779 X:41430646-41430668 TGGTGGGAATGGAGGGTGGGGGG - Intergenic
1190060310 X:47206571-47206593 TGGTGGGAAGTGAGGGAGGGAGG - Intronic
1190260495 X:48793948-48793970 TAGCGGGAATTGTGGGGAGGTGG + Exonic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1191749100 X:64521775-64521797 ACTTGGGAAATGAGGCAAGGAGG + Intergenic
1192303606 X:69933746-69933768 TCGTCTGAATGGAAGGAAGGGGG - Intronic
1192473413 X:71419335-71419357 TGGTGGGAATTGGAGGAAGTGGG - Intronic
1193794247 X:85853591-85853613 TCGTGGGAATAAAGAGGAGGTGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197606461 X:128591260-128591282 TCGGGGGAGTTGAGGGGAGGGGG - Intergenic
1197708516 X:129650503-129650525 TCTTGGGGAAAGAGGGAAGGAGG - Intronic
1199452438 X:147991551-147991573 TGAGGGGACTTGAGGGAAGGAGG - Intronic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic
1201572736 Y:15431905-15431927 TTGTGGGAGTTGGGGGAGGGGGG + Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic