ID: 1084399745

View in Genome Browser
Species Human (GRCh38)
Location 11:68936735-68936757
Sequence GTGGACCCGCAGCCTGTCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084399745_1084399749 -3 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399749 11:68936755-68936777 CACCAAATAGCCGAGGAGCACGG 0: 1
1: 0
2: 0
3: 12
4: 90
1084399745_1084399757 24 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399757 11:68936782-68936804 AGGCACGACAGTTCCGGGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 71
1084399745_1084399758 25 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399758 11:68936783-68936805 GGCACGACAGTTCCGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1084399745_1084399756 20 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399756 11:68936778-68936800 GCTGAGGCACGACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 152
1084399745_1084399750 -2 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399750 11:68936756-68936778 ACCAAATAGCCGAGGAGCACGGG 0: 1
1: 0
2: 0
3: 6
4: 81
1084399745_1084399755 19 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399755 11:68936777-68936799 GGCTGAGGCACGACAGTTCCGGG 0: 1
1: 0
2: 4
3: 112
4: 1841
1084399745_1084399754 18 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399754 11:68936776-68936798 GGGCTGAGGCACGACAGTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 112
1084399745_1084399747 -10 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399747 11:68936748-68936770 GCGGGTCCACCAAATAGCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 37
1084399745_1084399752 4 Left 1084399745 11:68936735-68936757 CCCACGACAGGCTGCGGGTCCAC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1084399752 11:68936762-68936784 TAGCCGAGGAGCACGGGCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084399745 Original CRISPR GTGGACCCGCAGCCTGTCGT GGG (reversed) Exonic
900381274 1:2385233-2385255 GTGTCCCCACCGCCTGTCGTCGG - Intronic
901018938 1:6246203-6246225 GTGAACCCGGTGCCTCTCGTGGG + Intergenic
905202122 1:36322499-36322521 GGGGCCCGGCAGCGTGTCGTCGG + Exonic
907457843 1:54586868-54586890 GTGGCCCTGCAGCCTGTCCTGGG - Intronic
920364522 1:205441029-205441051 GTGTTCCCCCAGCCTGGCGTAGG - Intronic
923540760 1:234886405-234886427 GGGGACCCCCAGGCTGCCGTGGG - Intergenic
1073290009 10:102408851-102408873 GTCGCCCCGCAACCTGGCGTGGG + Intronic
1076481378 10:130787101-130787123 GAGGACCAGCAGCCTTTCGAGGG - Intergenic
1077359947 11:2136463-2136485 GTGGCCCTGCAGCCTGTGGAGGG - Intronic
1077530780 11:3093825-3093847 GTGGCCCCGCAGCCCTTCTTCGG - Exonic
1078474672 11:11620718-11620740 CTGGACCCGCGGGCTGTGGTGGG + Intronic
1084399745 11:68936735-68936757 GTGGACCCGCAGCCTGTCGTGGG - Exonic
1085310516 11:75513936-75513958 GAGGTCCCACAGCCTGTCGGTGG - Intronic
1088597075 11:111448690-111448712 CTGGAAACGCAGCCTGTCCTTGG - Intronic
1089573055 11:119422804-119422826 GTAGACCCACAGGCTGTCCTTGG + Intronic
1095345290 12:41142558-41142580 GTGGGCCCCCAGTCTGTTGTGGG + Intergenic
1101236817 12:102797929-102797951 GTGGGCCCGGAGCGTGTTGTGGG + Intergenic
1102349982 12:112184901-112184923 GTGGAACCACAGCATGTCCTCGG + Exonic
1103477445 12:121229201-121229223 GGGGACCGGCAGCCTGCCCTTGG - Intronic
1115010554 14:28540142-28540164 GTGGCCCCCCAGCCTGTGATGGG - Intergenic
1121831589 14:97056853-97056875 GTGGTCCCACTGCATGTCGTAGG + Intergenic
1125512302 15:40298626-40298648 GTGGAGCAGCAGCTTGTCCTGGG + Exonic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1127619053 15:60715404-60715426 GTTGACCACCAGCCTGTCGCTGG - Intronic
1132478593 16:154418-154440 GAGGGGCCGCAGCCTGTCCTGGG - Exonic
1132480772 16:165174-165196 GAGGGGCCGCAGCCTGTCCTGGG - Intronic
1132576446 16:666528-666550 GTGGTTCCGCAGCCAGTCGGAGG - Exonic
1142666623 17:1467398-1467420 GTGGACCCCCACCCTGTCCCTGG + Intronic
1142709310 17:1714917-1714939 TTGGCCCCTCAGCCTGGCGTGGG - Intergenic
1147524832 17:41212736-41212758 GTGGTCCTGCAGCACGTCGTAGG - Intronic
1149661164 17:58334672-58334694 CTGGACTCGAAGCCTGACGTAGG + Intergenic
1152640161 17:81445928-81445950 GGGGTCCCGCTGGCTGTCGTAGG + Intronic
1159626941 18:70706344-70706366 GTGGACCTGCAGGATGTTGTGGG + Intergenic
1162850627 19:13428651-13428673 GTGGCCCCGCAGCCTGTGAAGGG + Intronic
1163266652 19:16226208-16226230 GGGGACCCTCAGCCAGGCGTGGG + Intronic
1164826995 19:31291106-31291128 GAGCAGCCGCAGCCTGTCATTGG - Intronic
1167259562 19:48450737-48450759 GTGGACCAGCGGCCATTCGTGGG + Exonic
928833493 2:35517332-35517354 GTGGGCCCCCAGTCTGTTGTCGG + Intergenic
929455781 2:42064063-42064085 GTGGAAAGGCAGCCTGTCTTTGG - Intergenic
938107810 2:128545224-128545246 GTGGACCCGGATCCTGTGCTGGG + Intergenic
941808599 2:169734099-169734121 GTGGACCCGCAGCCCGAGGCCGG + Intronic
948243014 2:236454149-236454171 GTGGGCCCGCAGGCTGTCCCAGG - Intronic
1169758587 20:9068315-9068337 GGAGACCCGCAGCCCGCCGTGGG - Intergenic
1172288389 20:33757344-33757366 GTGGGCCCCCAGCCTGCCATGGG + Intronic
1174485110 20:50856050-50856072 GCGACCCAGCAGCCTGTCGTGGG - Intronic
1175851916 20:62098200-62098222 CTGGACCTGCAGCGTGCCGTTGG + Intergenic
1180868265 22:19132163-19132185 GTGGAGCCGCTGGCTGACGTCGG - Exonic
1183440263 22:37818934-37818956 GTGGCCCTACAGCTTGTCGTGGG - Intergenic
1183748132 22:39704084-39704106 GTGAGCCCTCAGCCTGTCCTGGG + Intergenic
1183829834 22:40411829-40411851 GGGGACCCACAGACTGTCTTCGG + Exonic
950167174 3:10810216-10810238 TTGGACCCGCAGACTGACCTGGG + Intergenic
956570909 3:70693694-70693716 CTGGTCCCACAGCCTGTTGTAGG + Intergenic
985956300 5:3268573-3268595 GTGGCCACCCTGCCTGTCGTGGG + Intergenic
988073766 5:26326096-26326118 CAGGACCCGCAGCCTGCCCTGGG + Intergenic
998139967 5:139694183-139694205 GTGGACCCTCACCCTGGCCTTGG - Intergenic
1000210719 5:159104384-159104406 GTCGACCAGCAGCCTGGAGTCGG + Intergenic
1006117389 6:31782433-31782455 GTGTACCCCCAGCCGGTCGAAGG - Exonic
1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG + Intergenic
1015251849 6:131135600-131135622 GGGCCCCCGCAGCCTGTCGCTGG + Intergenic
1020022817 7:4879155-4879177 GGGCACCCGCGGCCTGTGGTGGG - Intronic
1033863930 7:145664517-145664539 TTGGACACCCAGCCTGTCGTGGG + Intergenic
1034990095 7:155542668-155542690 GAGGACATGCAGGCTGTCGTGGG + Intergenic
1040305349 8:46209071-46209093 ATGGGGCCGCAGCCTGGCGTGGG + Intergenic
1040415258 8:47189353-47189375 GTGCACCCTCCGCCTGTCCTGGG + Intergenic
1043069163 8:75617208-75617230 GTGGGCCCCCAGCCTGTTGGGGG + Intergenic
1046467696 8:114627971-114627993 GTAGCCCCACAGCCTGGCGTTGG - Intergenic
1057481219 9:95447093-95447115 GTGCACCCGCCGCCTGTCCCTGG - Exonic