ID: 1084400370

View in Genome Browser
Species Human (GRCh38)
Location 11:68939732-68939754
Sequence GGGGCGTGCAAGGATGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084400370_1084400380 11 Left 1084400370 11:68939732-68939754 CCGGCCGCATCCTTGCACGCCCC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1084400380 11:68939766-68939788 TCCATGGTAGCCCAGGGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 123
1084400370_1084400379 5 Left 1084400370 11:68939732-68939754 CCGGCCGCATCCTTGCACGCCCC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1084400379 11:68939760-68939782 GCTCTCTCCATGGTAGCCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 150
1084400370_1084400378 4 Left 1084400370 11:68939732-68939754 CCGGCCGCATCCTTGCACGCCCC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1084400378 11:68939759-68939781 AGCTCTCTCCATGGTAGCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 142
1084400370_1084400374 -5 Left 1084400370 11:68939732-68939754 CCGGCCGCATCCTTGCACGCCCC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1084400374 11:68939750-68939772 GCCCCGCGGAGCTCTCTCCATGG 0: 1
1: 0
2: 0
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084400370 Original CRISPR GGGGCGTGCAAGGATGCGGC CGG (reversed) Exonic
900707558 1:4090002-4090024 GGGGCTTACAAGGAGTCGGCAGG - Intergenic
901058621 1:6461283-6461305 GGGGCGAGCAGGGGTGGGGCCGG + Exonic
901129733 1:6954815-6954837 GCGGCGTCCAAGGAGGTGGCAGG - Intronic
901145643 1:7062792-7062814 GGGGCGAGGAAGGATCCGCCTGG - Intronic
901336556 1:8454374-8454396 GGGAAGTGAAAGGATGGGGCAGG + Intronic
904623463 1:31789255-31789277 GGGGCGGGGTAGGATGCGGGTGG - Intergenic
907136244 1:52142141-52142163 CGGGGGCGCAAGGCTGCGGCGGG - Exonic
907457136 1:54583018-54583040 GGGGCCTGCATGGATACGGGTGG - Intronic
914918858 1:151834242-151834264 GGGCCCTCCAAGGATGGGGCTGG - Intergenic
915549448 1:156624015-156624037 AGGGCGCGCCAGGATGCGGAGGG + Exonic
916890008 1:169105794-169105816 GGGGAGTGCGAGGGGGCGGCAGG + Exonic
922586663 1:226738597-226738619 GGGGCGTGCATGGCTGCAGCCGG + Intronic
923056011 1:230426283-230426305 AGGGCGGGCAGGGAGGCGGCGGG - Intergenic
923369436 1:233295607-233295629 GTGGGGTGGAAGGAGGCGGCGGG - Exonic
1063255280 10:4320765-4320787 GGGGAGTCCAGGGATGGGGCAGG + Intergenic
1067756418 10:49009084-49009106 GGGGCGGGTGAGGATGCTGCAGG - Intergenic
1069739684 10:70679492-70679514 GTGGCGTGCAAGGTTGGGGTCGG + Intronic
1070802895 10:79254152-79254174 AGGGCTTGCTAGGAAGCGGCTGG - Intronic
1074865792 10:117543709-117543731 GGGGCAGTGAAGGATGCGGCGGG - Intronic
1075813717 10:125247764-125247786 TGGGTGTGGAAGGATGCAGCGGG + Intergenic
1077580386 11:3413673-3413695 GGGGCGTGGGAGCTTGCGGCAGG - Intergenic
1078406382 11:11073792-11073814 GGGACCTGCAAGGATGAGCCAGG + Intergenic
1079101399 11:17544321-17544343 GGGTCGTGCAACGACGCAGCTGG - Intronic
1080550674 11:33371622-33371644 GGGGCGGGAAAGGATGCTGTGGG - Intergenic
1082807587 11:57460628-57460650 GGGGCGGGGAAGGCTGGGGCTGG - Exonic
1083612994 11:64013278-64013300 GGGGAGTGCCAGCATGGGGCAGG + Intronic
1084051937 11:66605707-66605729 GGAGCGTGCAATGATGCCACAGG - Exonic
1084400370 11:68939732-68939754 GGGGCGTGCAAGGATGCGGCCGG - Exonic
1084771959 11:71349200-71349222 GGAGCGTGGAAGGCTGGGGCTGG + Intergenic
1088058112 11:105610143-105610165 CGAACCTGCAAGGATGCGGCAGG + Exonic
1090978306 11:131694583-131694605 AGGGCGTGCAAGGCTGAAGCGGG + Intronic
1091493124 12:949888-949910 AGGGCGCGCAGGGAAGCGGCAGG - Intronic
1097895875 12:64824639-64824661 GGAGCCTGCAAGGCTGAGGCAGG - Exonic
1097895931 12:64824867-64824889 GGGGCGCTCTCGGATGCGGCAGG + Exonic
1100539876 12:95548275-95548297 GGAGGGTGGAGGGATGCGGCTGG + Intronic
1119519764 14:75277344-75277366 GGGGCGAGGCAGGATGAGGCCGG - Intergenic
1121137354 14:91510507-91510529 GGTGCGTGCAAGGAGGCGGGAGG - Intronic
1121255574 14:92528049-92528071 GGGGCGTGGAAGGGGGCTGCTGG + Intronic
1122221018 14:100239169-100239191 CGGGCGGGCGAGGAGGCGGCCGG - Exonic
1122309915 14:100787938-100787960 GGGGCTTGCAGGGCTGCGGGAGG - Intergenic
1122433740 14:101677556-101677578 GGAGCGGGTAAGGATTCGGCGGG + Intergenic
1122775995 14:104117174-104117196 GGGGCCAGCGAGGACGCGGCGGG + Intergenic
1125716822 15:41824089-41824111 GGGGAGAGTAAGGATGGGGCAGG - Intronic
1129517616 15:76166214-76166236 GGGGAGGGGAAGGATGCTGCGGG + Intronic
1129710684 15:77819084-77819106 GGGGCGTGCACGCTTGGGGCTGG - Intronic
1132588856 16:717735-717757 GGTGCGGGCAAGGACGGGGCTGG - Exonic
1133222030 16:4322951-4322973 GGGGAGAGCAGGGATGAGGCCGG - Intronic
1133735430 16:8611385-8611407 GGTGCATGTAAGGATGCAGCGGG + Intergenic
1134044914 16:11093921-11093943 GGTGCGTTCAGGGATGGGGCAGG + Intronic
1134132464 16:11659044-11659066 GGAGCCTGCAAGGAGGGGGCAGG + Intergenic
1135480122 16:22814875-22814897 GGGGCGGGCACGGCGGCGGCGGG - Exonic
1135525682 16:23212163-23212185 GGGGCATGCAAGGCTGGAGCTGG - Intronic
1137606083 16:49787738-49787760 GTGGCGTGCAAGGAGGGTGCTGG - Intronic
1138392757 16:56682389-56682411 GGCGGGTGCAAGGACGAGGCGGG + Intronic
1142509765 17:386087-386109 GGGGCGCACAGGGAGGCGGCGGG - Intronic
1143668902 17:8383141-8383163 GGAGCGGGTAAGGATTCGGCGGG - Exonic
1144506311 17:15834218-15834240 GGGATGTGCAGGGCTGCGGCAGG + Intergenic
1144675453 17:17158705-17158727 GGAGCGTGCACGGAGGCGGGAGG + Exonic
1145170487 17:20652151-20652173 GGGATGTGCAGGGCTGCGGCAGG + Intergenic
1145414553 17:22703972-22703994 GGGGCGCGCGAGGCTGCCGCTGG + Intergenic
1147587087 17:41658916-41658938 GGGGCTGGCAGGGATGAGGCAGG + Intergenic
1149432571 17:56606007-56606029 GGGGCAAGCAAGGGTGGGGCAGG - Intergenic
1150004707 17:61462564-61462586 GGAGCGCGCAAGGAGGGGGCTGG + Intronic
1150268783 17:63849261-63849283 GGGGCGCGCGAGGGTGCGGCCGG - Intergenic
1153889672 18:9501240-9501262 GAGAGGTGCAAGGATGAGGCAGG - Intronic
1155690032 18:28608631-28608653 GGTGGGTGCAGGGATGTGGCTGG - Intergenic
1159770878 18:72543942-72543964 GGGGCGTTGGAGGGTGCGGCGGG - Intronic
1160330667 18:77988496-77988518 GGGGCGAACAAGGATGCGTCAGG + Intergenic
1160714951 19:572354-572376 GGGGCCTGCGGGGACGCGGCTGG - Intronic
1160992073 19:1864049-1864071 GGGGCGTGCCGGGATGGGGCGGG - Intergenic
1161779262 19:6280087-6280109 GGGGCCTGCCGGGCTGCGGCCGG + Intergenic
1162126000 19:8499826-8499848 GGGGCATGGAAGGATGGGCCTGG + Intronic
1164261374 19:23570920-23570942 GGGCCGTGCAGGGATGGGGAAGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166832119 19:45645188-45645210 GGGACTTGCAAGGAGGAGGCTGG + Intronic
1167516959 19:49929130-49929152 GGGGCGCGGAAGGATCCGGGAGG + Exonic
1167666751 19:50826856-50826878 GGTGCGTGAAAGGATGGAGCTGG - Exonic
927714555 2:25343103-25343125 GGGGCGCGCAAGGAGGCTGGAGG - Intergenic
931134898 2:59387469-59387491 GGGGTGTGCAATGATGCCCCAGG + Intergenic
934571381 2:95375113-95375135 GGGGAGGGCAAGGAAGAGGCTGG - Intronic
937925870 2:127166856-127166878 GGGTGGGGCAAGGATGGGGCAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
948856890 2:240734386-240734408 GGGGCAGGCAAGGCTGGGGCAGG + Intronic
948918758 2:241051785-241051807 GGCACGTGCAAGGAGGCGGGCGG + Exonic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172187021 20:33037196-33037218 GGGGCGTGTAAGAATCCTGCTGG - Intronic
1176140656 20:63543316-63543338 GGGGCATGCAGGGCTGCAGCAGG + Exonic
1178330422 21:31685670-31685692 GAGGCGTGAAAGCAGGCGGCTGG + Exonic
1184543532 22:45148078-45148100 GGGACTTGCAAGGCTGAGGCAGG - Intergenic
1184660086 22:45961626-45961648 GGGGTGGGCAAGGACGGGGCTGG + Intronic
1185359220 22:50395346-50395368 AGGGTGAGCAAGGATGGGGCTGG + Intronic
1185393110 22:50573233-50573255 GGTGCGTGCCAGGCTGCGCCTGG + Intronic
950116329 3:10452443-10452465 GGTCCGTGCAGGGATGGGGCGGG + Intronic
950633188 3:14297825-14297847 GGGTCGGGCCAGGCTGCGGCGGG - Intergenic
953626898 3:44579264-44579286 GGAGCGTGCACGGAGGCGGGAGG - Intronic
954432993 3:50481199-50481221 GGGGCGAGAAAGGATGGGGGAGG + Intronic
955130272 3:56158957-56158979 GGGGCCTGCAAGGAGGTGACTGG + Intronic
957737707 3:84224505-84224527 GGGCCCAGCAAGGCTGCGGCAGG - Intergenic
959904291 3:111693481-111693503 GTGACTTGCAAGGATGAGGCAGG - Intronic
961530457 3:127537157-127537179 GGGGCCTGCAAGGAGGAGGAAGG - Intergenic
968650566 4:1758771-1758793 GGGACGTGCAGGGAAGGGGCTGG - Intergenic
968674672 4:1871211-1871233 GGGGCGGGCAGGCACGCGGCGGG - Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969565027 4:7972246-7972268 GAGGCGTGCAAGGCTGTGGAGGG - Intronic
969873184 4:10117001-10117023 GGGGCGAGCAAGGCGGAGGCGGG - Intergenic
970216790 4:13767253-13767275 GGGGCGGGCAAGGCTACGGCTGG + Intergenic
981244447 4:142517520-142517542 AGGGAGTGCAAGGATGCACCTGG - Intronic
985544963 5:504821-504843 GGGGAGGGCAGGGGTGCGGCTGG + Intronic
992091088 5:73317579-73317601 GGGGCGTGCAGGGATGCTTGGGG - Intergenic
996830256 5:127732830-127732852 GGGGCCTGCAAGGGTGAGGGTGG + Intergenic
999279798 5:150357709-150357731 GGGGCGTGCAGGTAGCCGGCCGG + Exonic
1001254303 5:170171869-170171891 GGGGAGGGCAAGGGTGCTGCGGG - Intergenic
1001674754 5:173502559-173502581 GGGGAGGGCAAGGAGGCGGGGGG + Intergenic
1002193592 5:177491026-177491048 GAGGTGGGCAAGGATGCGGAAGG + Exonic
1014045213 6:116877152-116877174 GGGGCGGGGAAGGAGGCCGCAGG - Intergenic
1018612897 6:165661641-165661663 GGGGCGGAGAAGGAGGCGGCAGG + Intronic
1019381812 7:727757-727779 GCGGCGTGCAAGGAGGAGGATGG - Intronic
1024241586 7:47440179-47440201 GGTGCGGCCAAGGATGAGGCTGG + Intronic
1029206157 7:98870291-98870313 GTGGAGGGGAAGGATGCGGCCGG - Intronic
1029546268 7:101212113-101212135 GGGGGCTGCAAGGATGCGAATGG + Intronic
1032434028 7:131885469-131885491 GAGGCCTGCAAGGAGGAGGCAGG - Intergenic
1035850993 8:2919180-2919202 GGGGCCTGGGAGGATGCTGCAGG - Intergenic
1038537946 8:28368035-28368057 GGGGCGTGCATGTATGTGGTGGG + Intronic
1044137487 8:88605278-88605300 GGGGCCTGCAAGGAAGAGGTAGG + Intergenic
1049199064 8:141331092-141331114 GGAGCCTGCAGGGATGCGGAGGG + Intergenic
1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG + Intergenic
1058460919 9:105181899-105181921 GTGGCGTGCAAAGATGTAGCTGG + Intergenic
1060527459 9:124328521-124328543 GCGGTGTTCAAGGAGGCGGCGGG - Intronic
1060856193 9:126915761-126915783 GGGGCTTGCCAGGATGCGGGGGG + Intronic
1061365560 9:130171188-130171210 GGGGCTAGCAGGGATGAGGCAGG - Intergenic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1187698065 X:21940743-21940765 GCGGCGTGTCAGGCTGCGGCCGG - Exonic
1192156946 X:68753695-68753717 GGGGCCTGCAAGGAGGAGGGGGG + Intergenic
1200098183 X:153673852-153673874 GGGGCGTGCGCGGAGGGGGCGGG - Intronic
1200136074 X:153875431-153875453 GGGGCGGGCAGAGATGGGGCGGG + Intronic
1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG + Exonic