ID: 1084400432

View in Genome Browser
Species Human (GRCh38)
Location 11:68939942-68939964
Sequence GTGCTCGTGCAGGTGGGGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084400427_1084400432 -9 Left 1084400427 11:68939928-68939950 CCTGGGGGACAACAGTGCTCGTG 0: 1
1: 0
2: 1
3: 1
4: 93
Right 1084400432 11:68939942-68939964 GTGCTCGTGCAGGTGGGGCTTGG 0: 1
1: 0
2: 0
3: 13
4: 317
1084400422_1084400432 17 Left 1084400422 11:68939902-68939924 CCGATGTCACAATGTGGAGGAAA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1084400432 11:68939942-68939964 GTGCTCGTGCAGGTGGGGCTTGG 0: 1
1: 0
2: 0
3: 13
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084400432 Original CRISPR GTGCTCGTGCAGGTGGGGCT TGG Exonic
900125477 1:1067281-1067303 GTGCAGGTGCAGGTGCGGCGGGG - Intergenic
900125878 1:1068798-1068820 GTGCAGGTGCAGGTGCGGCGGGG + Intergenic
900175101 1:1288059-1288081 GTGCGGGGGCAGGTGAGGCTGGG + Intronic
900181001 1:1310927-1310949 GTGCTGGTGGCCGTGGGGCTGGG + Exonic
900338988 1:2178946-2178968 GTGCTGGTTCAGCTGGGGATAGG - Intronic
900386805 1:2414372-2414394 GTTCCTGGGCAGGTGGGGCTTGG + Intergenic
901162757 1:7192598-7192620 CTGCTCCTGCAGGTGGCACTCGG - Intronic
901185225 1:7368559-7368581 GTGCTAGTGGGGGTGGGGCCTGG - Intronic
901241527 1:7696913-7696935 TTGCTGGTGCAGGCTGGGCTGGG + Intronic
902448756 1:16483988-16484010 GTGCTTGGGCAGCTGGGGGTGGG - Intergenic
902468136 1:16630661-16630683 GTGCTTGGGCAGCTGGGGGTGGG - Intergenic
902506023 1:16939368-16939390 GTGCTTGGGCAGCTGGGGGTGGG + Intronic
902983221 1:20139991-20140013 GCGCTCCTCCAGGAGGGGCTGGG + Intronic
903155006 1:21437027-21437049 GTGCTTGGGCAGCTGGGGGTGGG + Intergenic
903305517 1:22410173-22410195 GTGCTCATGCAGTAGGGGTTTGG + Intergenic
903935060 1:26889897-26889919 GTGGGCGAGCTGGTGGGGCTGGG - Exonic
904290341 1:29481259-29481281 GTGCTGGTGTGGGTGGGGCATGG + Intergenic
904661810 1:32091174-32091196 GTGATAGGGCAGGTGGGGGTGGG - Intronic
904732970 1:32608697-32608719 AATCTCGGGCAGGTGGGGCTTGG + Intronic
905059972 1:35131716-35131738 GTGCCCGTGCAAGTGTGGCATGG - Intergenic
905202080 1:36322320-36322342 GTGCCCGTGGCCGTGGGGCTGGG + Exonic
906587707 1:46994377-46994399 GTGCCTGTGCAGTTAGGGCTGGG + Intergenic
907045977 1:51300297-51300319 GGTCTGGGGCAGGTGGGGCTGGG - Intronic
912454503 1:109788602-109788624 GTGCTGGTGCAGGTGTGCCGAGG - Intergenic
912490749 1:110061405-110061427 GTCCTGGTTCAGGTAGGGCTGGG + Intronic
912816366 1:112831955-112831977 GTGCCTGTGCAGGTGTGGCATGG + Intergenic
912965275 1:114231513-114231535 GTTCTTATTCAGGTGGGGCTGGG - Intergenic
914666911 1:149840167-149840189 GTGCTAGTGGAGGTGGCGCGGGG + Exonic
914668856 1:149853623-149853645 GTGCTAGTGGAGGTGGCGCGGGG - Exonic
915245165 1:154551362-154551384 GTCCTGGGGCTGGTGGGGCTGGG - Intronic
916194428 1:162210274-162210296 GTGCTCTTGAAGGTCGAGCTGGG - Intronic
918451289 1:184661547-184661569 GAGCTCCTGGAGGTGGGGGTGGG + Intergenic
921139664 1:212295228-212295250 GTGCTTGTCCAAGTGGGGATGGG + Intronic
921157020 1:212446573-212446595 GTGCACGTGCAGCTGGAGATTGG + Intergenic
922174878 1:223189426-223189448 GGGCTGGTGCAGGTGGGGGCTGG + Intergenic
922174926 1:223189586-223189608 GAGCTGGTGCAGGTGGGGGCTGG + Intergenic
922174940 1:223189634-223189656 GGGCTGGTGCAGGTGGGGGCTGG + Intergenic
922174971 1:223189746-223189768 GGGCTGGTGCAGGTGGGGGCTGG + Intergenic
922902350 1:229146937-229146959 GAGCTGGTGCTGGTGCGGCTGGG - Intergenic
924463820 1:244282844-244282866 ATGCTTGTGAAGGTGGGGCCTGG - Intergenic
1063330323 10:5151987-5152009 GTACTCATGCAGGCTGGGCTGGG + Intergenic
1064689031 10:17894815-17894837 GAGCTAATGCATGTGGGGCTAGG - Intronic
1065583109 10:27191500-27191522 GAGGTTGTGCAGGTGGGGCGGGG + Intergenic
1069813719 10:71180356-71180378 GTGCTCTGGCAGGAGGAGCTGGG - Intergenic
1069939633 10:71945742-71945764 GTGCCCGTGCAAGTGTGGCATGG + Intergenic
1070680495 10:78445714-78445736 GTGCTGGAGCAGGTGGGGAAGGG - Intergenic
1071208651 10:83313018-83313040 GTTCTAGTACAGGTGGGGTTAGG + Intergenic
1071282630 10:84116421-84116443 GTGCGCGTGCAAGTGTGGCATGG + Intergenic
1072335215 10:94391843-94391865 GTGCCCGTGCAAGTGTGGCATGG + Intergenic
1073117583 10:101100421-101100443 GGGCTGGTGCCGGTGGGGCAGGG - Intronic
1074516259 10:114173655-114173677 ATTCTCGAGCAGGTAGGGCTTGG + Intronic
1074868593 10:117559709-117559731 GTGGTCATGCAGGCTGGGCTTGG + Intergenic
1076462422 10:130656102-130656124 GCGGACGTGCAGGTGGGGGTGGG + Intergenic
1076462432 10:130656125-130656147 GCGGGCGTGCAGGTGGGGGTGGG + Intergenic
1076462441 10:130656148-130656170 GCGGACGTGCAGGTGGGGGTGGG + Intergenic
1076462451 10:130656171-130656193 GCGGGCGTGCAGGTGGGGGTGGG + Intergenic
1076462460 10:130656194-130656216 GCGGACGTGCAGGTGGGGGTGGG + Intergenic
1076576597 10:131473905-131473927 GTGCCCCTGCGGCTGGGGCTGGG - Intergenic
1076818498 10:132926327-132926349 GGGGTCGTGCAGGTGGGGGCTGG - Intronic
1076875536 10:133213884-133213906 CTGCTGGTGCAGGGTGGGCTGGG - Intronic
1077091244 11:779312-779334 GGGCCAGTGCAGGTGGGGCTGGG - Intronic
1077100881 11:821849-821871 GAGCTCATCCAGGTGGGGCCTGG + Exonic
1079494287 11:21023756-21023778 GTGCACATGCAGGTGGGGGCTGG - Intronic
1082131179 11:48491199-48491221 GTGTTCCTGCAGGAGGGACTGGG + Intergenic
1082245629 11:49918929-49918951 GTGTTCCTGCAGGAGGGACTGGG - Intergenic
1082564678 11:54662076-54662098 GTGTTCCTGCAGGAGGGACTGGG + Intergenic
1083090293 11:60192429-60192451 GTGCCCGTGCAAGTGTGGCATGG + Intergenic
1083204501 11:61140127-61140149 GTGCTGGTGCAGGTGGGCTGTGG - Intronic
1083803325 11:65058912-65058934 CTGCTCAGGCAGGTAGGGCTGGG - Intergenic
1084185079 11:67467311-67467333 CTGCTCCTGCTGCTGGGGCTGGG - Exonic
1084270280 11:68025845-68025867 GTGATGGTACAGGTGGGGCAGGG - Intronic
1084400432 11:68939942-68939964 GTGCTCGTGCAGGTGGGGCTTGG + Exonic
1084713884 11:70861466-70861488 GTTCAGGTGCAGGTAGGGCTGGG - Intronic
1085240145 11:75046381-75046403 GTGCCCGTGCAAGTGTGGCATGG + Intergenic
1087276690 11:96167979-96168001 GAGCTCCTGCGGTTGGGGCTGGG + Intronic
1087895147 11:103578340-103578362 GTGCCCTTGCAGGTGTGGCATGG + Intergenic
1088020418 11:105111867-105111889 GTGCTCCTTTAGGTGGGACTGGG + Intergenic
1090739347 11:129643000-129643022 GTGCTTGTGCTGTTGGGGCTAGG + Intergenic
1091632661 12:2173688-2173710 GTGGTGGAGCAGGTGGGGGTAGG - Intronic
1092815880 12:12311968-12311990 GTGCTTGTGGTGGTGGGGGTGGG - Intergenic
1093547992 12:20369798-20369820 GCGCTCGTCCAGATTGGGCTGGG + Exonic
1094496965 12:30994655-30994677 GGGCTCCTGGAGATGGGGCTAGG - Exonic
1094720915 12:33063182-33063204 GTGCTCCTGCAGACAGGGCTGGG + Intergenic
1095102924 12:38202139-38202161 GTGCTCGTGGATCTGGAGCTGGG + Intergenic
1095752676 12:45729267-45729289 GGGCTAGGGCAGGCGGGGCTGGG - Intergenic
1096616330 12:52835267-52835289 GGGCTCCTGCATGTGGGGCAGGG - Intergenic
1097189589 12:57213061-57213083 GTGCCCCTGGAGTTGGGGCTGGG - Exonic
1098248793 12:68547205-68547227 GTGCCCGTGCAAGTGTGGCATGG + Intergenic
1101528753 12:105555932-105555954 GTGCTCCAGCAGGTGGACCTTGG + Intergenic
1102033463 12:109758050-109758072 GTGGCCCTGCTGGTGGGGCTGGG - Intronic
1102454877 12:113065185-113065207 GAGCTGGAGCAGGTGGGGCAGGG + Intronic
1104444621 12:128823444-128823466 GGGCTGGTGCTGGTGGGCCTGGG - Exonic
1105707986 13:22980645-22980667 GTGCTGGTGAAAGTGGAGCTCGG - Intergenic
1106159132 13:27184982-27185004 TTGCTCCTGGAGCTGGGGCTAGG + Intergenic
1110551934 13:76820404-76820426 GTGCTGTTGGAGGTGGGCCTAGG - Intergenic
1110587222 13:77207953-77207975 GGGCTGGGGCGGGTGGGGCTTGG - Intronic
1112505092 13:99970614-99970636 GTGGTGCTGCAGGTGGGGCCCGG + Exonic
1113775000 13:112938994-112939016 GTCCTCGTGCAAGAGGGACTTGG - Intronic
1117954891 14:61115126-61115148 GTGCCCATGCAGGTGTGGCATGG - Intergenic
1118280523 14:64424138-64424160 GTGCACTTCCAGGAGGGGCTGGG - Intronic
1118850355 14:69578279-69578301 AAGCTAGTACAGGTGGGGCTGGG + Intergenic
1119606351 14:76021187-76021209 GTGCTAGTGGTGGTGGGGGTTGG + Intronic
1121120432 14:91372558-91372580 GTGTTAGTGCAGGGAGGGCTAGG + Intronic
1122630028 14:103103515-103103537 GCGCTCCTGCCGGTGGGGCTGGG - Intronic
1122766331 14:104073615-104073637 GTGCTTGTGCATGTCGGGATGGG + Intergenic
1122795059 14:104201853-104201875 GTGGTGGGCCAGGTGGGGCTGGG - Intergenic
1122830851 14:104394894-104394916 GTCCTCCTGGAGATGGGGCTGGG + Intergenic
1123406293 15:20021052-20021074 GTGCTGGTGCTGGTGCTGCTGGG + Intergenic
1123515623 15:21027700-21027722 GTGCTGGTGCTGGTGCTGCTGGG + Intergenic
1124483882 15:30099731-30099753 GTGCACGTGCGGGTGTGGCAAGG + Intergenic
1124519697 15:30397493-30397515 GTGCACGTGCGGGTGTGGCAAGG - Intergenic
1124538956 15:30568728-30568750 GTGCACGTGCGGGTGTGGCAAGG + Intergenic
1124759693 15:32438844-32438866 GTGCACGTGCGGGTGTGGCAAGG - Intergenic
1125589181 15:40844079-40844101 GTGCTCGGAGAGCTGGGGCTCGG - Exonic
1125796732 15:42409027-42409049 GGGCTCTTGCAGGTGGGGACTGG + Intronic
1125832154 15:42724551-42724573 GGGTTCTGGCAGGTGGGGCTCGG + Exonic
1127290843 15:57569674-57569696 GTGCTCTTGGAGCTGGGCCTGGG - Intergenic
1128053798 15:64684957-64684979 GGGCTGGGGCAGGAGGGGCTGGG - Exonic
1128235656 15:66065574-66065596 GTCCTTGGGCAGGTGGGGGTGGG + Intronic
1128245196 15:66128060-66128082 GTGCTAGTGCAGGGAGGGGTAGG + Intronic
1128495850 15:68198104-68198126 GGGCCCGTGGAGGAGGGGCTGGG - Intronic
1129117290 15:73371646-73371668 CTGCTCATGCAGGTGGGGTAGGG + Intergenic
1129876346 15:78978065-78978087 GGGCTGTTGCAGGTGGGGCAAGG + Intronic
1131227623 15:90638543-90638565 GGGCTGCTGCAGGAGGGGCTGGG - Exonic
1132238540 15:100239879-100239901 GTGATCCTGAAGGTGGGGCGTGG - Intronic
1132500681 16:283373-283395 GTGCTGGGGCCAGTGGGGCTGGG + Intronic
1132550735 16:552939-552961 CTGCACGTGCAGGTAGGCCTTGG - Exonic
1132973929 16:2702185-2702207 GTGCTCGTGCAGGTGTTCCGGGG + Intronic
1135389110 16:22074101-22074123 GTGCACGTGCACGTGTGGCTAGG - Intronic
1135712522 16:24729810-24729832 GTGCACGAGCAAGTGGGGCGCGG - Exonic
1135854303 16:25992823-25992845 GTGCTGGAGCAAGTGTGGCTTGG - Intronic
1136253907 16:29025501-29025523 GTGCTCCTGCAGGTGGGAGGTGG + Intergenic
1136275390 16:29176759-29176781 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1136515437 16:30765339-30765361 GTGCTGGGGCAGGTGAGGCAAGG + Intronic
1137262426 16:46842707-46842729 GTGCTGGTGCAGATGCGGGTGGG - Intergenic
1137670079 16:50273723-50273745 GAGCTCATGCAGTTGGGACTGGG + Intronic
1140028418 16:71312987-71313009 GTGGTCATGCAGGTGGGTATTGG - Intergenic
1141042290 16:80682797-80682819 GGGCTCGTGTAAATGGGGCTTGG - Intronic
1141109335 16:81259075-81259097 GTGATGTTGCAGGTGGGCCTAGG - Intronic
1141710322 16:85695254-85695276 GTTCTACTGCAGATGGGGCTGGG - Intronic
1142005029 16:87685548-87685570 GTGCACGTGCATGTGGGGAGTGG + Intronic
1142079750 16:88142824-88142846 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1142571643 17:878498-878520 GTGCCCTTGAAGGTGGGGTTTGG + Intronic
1142742292 17:1938093-1938115 GAGCTGGAGCAGGTGGGGCTGGG - Intronic
1143369258 17:6428307-6428329 GAGCTGCTGCAGGTGGGGCTGGG - Exonic
1143428724 17:6862930-6862952 GTGCTTGTGCTGGTGGTGATGGG + Intergenic
1144591893 17:16531385-16531407 GTGCTGGTGCTGGTGAGGCATGG - Intergenic
1145264361 17:21372465-21372487 GTGATGGTGCAGGTGGAGTTGGG + Intergenic
1146264628 17:31444223-31444245 GTGCTGGTGGAGGTGTGGGTGGG + Intronic
1147809916 17:43161002-43161024 GTGCCCGTGCAAGTGTGGCATGG - Intergenic
1148050462 17:44767655-44767677 GTGCCGGGGCAGCTGGGGCTGGG - Intronic
1148070010 17:44903316-44903338 GTTCTTGTGCAGGTTGGGCCTGG + Exonic
1149422924 17:56528294-56528316 GTGCATGTGCAGCTGGGACTGGG + Intergenic
1152455356 17:80412757-80412779 GTGCCCGTGCAAGTGTGGCATGG + Intergenic
1152623432 17:81377629-81377651 GAGCAGGTGCTGGTGGGGCTGGG + Intergenic
1152855750 17:82663934-82663956 GCCCTGGTGCAGCTGGGGCTGGG + Intronic
1152913822 17:83022279-83022301 ACGCTGGTGCAGGTGGGGCGGGG - Intronic
1152913846 17:83022420-83022442 ACGCTGGTGCAGGTGGGGCGGGG - Intronic
1152913928 17:83022890-83022912 ACGCTGGTGCAGGTGGGGCGGGG - Intronic
1152913976 17:83023172-83023194 ACGCTGGTGCAGGTGGGGCGGGG - Intronic
1152913992 17:83023266-83023288 ACGCTGGTGCAGGTGGGGCGGGG - Intronic
1152914000 17:83023313-83023335 ACGCTGGTGCAGGTGGGGCGGGG - Intronic
1152914009 17:83023360-83023382 ATGCTGGTGCAGGTGGGCCGGGG - Intronic
1203161575 17_GL000205v2_random:57092-57114 GTGATCGTGCAGGTGGGCAGTGG - Intergenic
1153830774 18:8920595-8920617 GTGCCCGTGCAAGTGTGGCACGG + Intergenic
1154169606 18:12041445-12041467 GTGGTGGTGCAGGTGGGGGTGGG + Intergenic
1155972450 18:32093915-32093937 ATGTTCGGGCAGGTGGGGCCTGG + Intronic
1158259661 18:55592647-55592669 CTGCTGGGGCTGGTGGGGCTGGG - Intronic
1160369776 18:78362430-78362452 GTGCTTGTGCACTTCGGGCTTGG + Intergenic
1160777132 19:861525-861547 GTGGGGGTGCAGGTGGGGATGGG - Intronic
1160780947 19:877789-877811 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160780962 19:877845-877867 CTGCTGGGGCATGTGGGGCTGGG - Intronic
1160780979 19:877901-877923 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781001 19:877969-877991 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781019 19:878031-878053 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781059 19:878181-878203 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781101 19:878305-878327 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781123 19:878373-878395 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781167 19:878503-878525 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781186 19:878565-878587 CTGCTGGGGCATGTGGGGCTGGG - Intronic
1160781203 19:878627-878649 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781256 19:878795-878817 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781281 19:878863-878885 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781352 19:879073-879095 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781377 19:879141-879163 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781399 19:879229-879251 CTGCTGGGGCATGTGGGGCTCGG - Intronic
1160781418 19:879317-879339 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781449 19:879429-879451 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781466 19:879485-879507 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781502 19:879621-879643 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781518 19:879677-879699 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781542 19:879765-879787 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1161319576 19:3634704-3634726 GTGCTCCTGCAGGTGAGGTCTGG - Intronic
1161509942 19:4664725-4664747 ATGCACGTGCAGGTGGGGGGTGG - Intronic
1163236988 19:16035622-16035644 GTTCTCGGGCAGGTGGAGCATGG + Intergenic
1164797050 19:31041725-31041747 GTGCAGGTGCAGGCTGGGCTTGG - Intergenic
1164847634 19:31448230-31448252 GTGGTCTTGGAGGTGGGTCTTGG + Intergenic
1165096849 19:33414153-33414175 GGCCTCCTGCAGGTGGGGCAGGG + Intronic
1165157817 19:33798427-33798449 CTGCTCGGGCGGGCGGGGCTCGG + Exonic
1165432436 19:35780511-35780533 GGGCGCGGACAGGTGGGGCTGGG + Intronic
1166142353 19:40811872-40811894 GGATTCGTGAAGGTGGGGCTGGG - Intronic
1166185169 19:41134925-41134947 GGATTCGTGGAGGTGGGGCTGGG + Intergenic
1166781955 19:45347646-45347668 GTGACAGTGCAGGTGAGGCTGGG + Intronic
1168169634 19:54576803-54576825 GAGCCCGGGGAGGTGGGGCTGGG + Intronic
1168401072 19:56086711-56086733 GTGCGCGTGCCCGAGGGGCTTGG - Intergenic
925191953 2:1892245-1892267 GTGCTGCTGCTGCTGGGGCTGGG + Exonic
925820332 2:7793671-7793693 GTGATTGTGCAGCTGGGGCTCGG + Intergenic
926007066 2:9380774-9380796 GTGCTCGTGCTTGAGGCGCTTGG - Exonic
926197531 2:10772842-10772864 CTGCTCGGCCAGGTGGGGCCAGG - Intronic
927476912 2:23420647-23420669 GAGCTCTGGCAGGTGGGGCAGGG - Intronic
927668560 2:25049725-25049747 GTGTGCGTGGAGGTGGGGATGGG + Intronic
928925918 2:36579413-36579435 GTGATGCTGGAGGTGGGGCTTGG + Intronic
929779228 2:44947054-44947076 GTGCTGGTGCTGCTGGGGATGGG - Intergenic
933987440 2:87603645-87603667 CTGCTGGTGCCTGTGGGGCTGGG + Intergenic
934079215 2:88452801-88452823 GCGCGCGGGCAGGTGGGGCGTGG - Intergenic
934756834 2:96830239-96830261 GTGGTGGGGCAGGTGGGGGTGGG - Intronic
935028876 2:99303331-99303353 GTGCTTTTGTAGGTGGAGCTGGG - Intronic
936306399 2:111347163-111347185 CTGCTGGTGCCTGTGGGGCTGGG - Intergenic
937004794 2:118501445-118501467 GTGGTGAGGCAGGTGGGGCTGGG + Intergenic
937536807 2:122898958-122898980 GTGCTTGTGCAGGTGAGTCGAGG - Intergenic
938071687 2:128311758-128311780 GTGTGGGTGCAGGTGGGTCTAGG - Intronic
945374880 2:209068016-209068038 TTGCTGGTGGAGGTGGGGGTGGG + Intergenic
948091666 2:235301071-235301093 GTGCTCCTCTAGATGGGGCTAGG + Intergenic
948116613 2:235498080-235498102 GAGCGCGTGGAGGTGGGTCTGGG + Intronic
948260979 2:236604257-236604279 GTGCTCGTGCTGGAGGCACTGGG + Intergenic
948686302 2:239671922-239671944 GTGCTTTTCCAGGTGAGGCTTGG + Intergenic
948798500 2:240419432-240419454 GTGCTCTGGGAGGTGGGGGTCGG - Intergenic
1171245326 20:23606140-23606162 GTGCTGGGGCAGCTGGGGCTGGG - Intergenic
1172093169 20:32447738-32447760 GTGCTGGTGCTGGAGGGGGTGGG + Exonic
1173501344 20:43556379-43556401 GTGAATCTGCAGGTGGGGCTGGG + Intronic
1175345203 20:58268202-58268224 ATTCTCGTGCATGTGGGGATGGG - Intergenic
1175647051 20:60683843-60683865 TTGCTCGTGGAGGCTGGGCTCGG - Intergenic
1175787101 20:61718562-61718584 GAGCCTGTGCAGGTGGTGCTTGG - Exonic
1180148904 21:45937697-45937719 TTGCAGGTGCAGGTGGGGCCAGG + Intronic
1180163612 21:46009073-46009095 GTCCTGGTGCAGGAGGAGCTGGG + Intergenic
1183353031 22:37344176-37344198 GTGCATGGGCAGGTGGGGTTGGG - Intergenic
1183575405 22:38685257-38685279 GCGCTCGGGATGGTGGGGCTGGG + Exonic
1183672757 22:39282872-39282894 GTGCGTGTGCAGCTTGGGCTGGG - Intergenic
1184588022 22:45460809-45460831 GTGCTCAAGGAGGTGGGGCCAGG - Intergenic
1184692727 22:46124547-46124569 GGGCTGGTGGAGGTGAGGCTGGG - Intergenic
1184872919 22:47252168-47252190 GGGCTCCTGCAGGTGGGGTGGGG - Intergenic
1184902896 22:47458515-47458537 CTGCTTCTGCAGATGGGGCTGGG - Intergenic
1185343467 22:50301562-50301584 GAGAGCCTGCAGGTGGGGCTGGG - Intronic
950423613 3:12912911-12912933 GGGCTCCAGGAGGTGGGGCTTGG + Intronic
952961116 3:38589690-38589712 GAGCTCCTACAGGTGGGGCCCGG + Intronic
953418359 3:42735824-42735846 TTGCTGGTCCAGGTGGTGCTGGG + Exonic
954427340 3:50450318-50450340 GTGCGGGGGTAGGTGGGGCTTGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954912843 3:54122904-54122926 GGGCGCCTGCAGGTGCGGCTGGG + Intronic
956751499 3:72347481-72347503 ATTCTCGTGCAGAAGGGGCTGGG + Intergenic
956995636 3:74824228-74824250 GTGCTTGTTCTGGTGGGGGTGGG + Intergenic
961522566 3:127475511-127475533 GTGCAGCTGCAGATGGGGCTGGG - Intergenic
961797249 3:129418383-129418405 GGGCTCGGGCAGCTGGAGCTGGG + Exonic
963001119 3:140682764-140682786 GTGCTCCTGCATGTAGCGCTTGG - Exonic
968429322 4:546044-546066 GTCCTCGTGGGGGTGGGGGTGGG + Intergenic
968629517 4:1642768-1642790 GTGACCCGGCAGGTGGGGCTGGG - Intronic
968655501 4:1776831-1776853 GCGCTCGTCCAGGCTGGGCTGGG + Intergenic
968746330 4:2362500-2362522 GGGCATGTGCAGGAGGGGCTGGG - Intronic
969504350 4:7574935-7574957 GTGCTCTTGCAGGAGGGCCCAGG - Intronic
969608480 4:8214085-8214107 CTGATGCTGCAGGTGGGGCTGGG + Intronic
969662259 4:8537154-8537176 CTGCTTGTGCTGGTGGAGCTGGG + Intergenic
969979662 4:11141596-11141618 GAGCTCCAGCAAGTGGGGCTGGG + Intergenic
972786420 4:42330555-42330577 GTGCTCGTGCATGTTGGGCAAGG - Intergenic
972990822 4:44821064-44821086 GTGCCCGTGCAGGTGTGGCAAGG - Intergenic
974543943 4:63275738-63275760 GTGGTGGTGCAGTTGGGGCAGGG - Intergenic
975440758 4:74407279-74407301 GTGCTGGTGGGGGTGGGGGTGGG + Intergenic
979677186 4:123422757-123422779 GTGATAGTGAAGGTGGGACTGGG + Intergenic
985889188 5:2702317-2702339 ATGCACGGGCTGGTGGGGCTCGG - Intergenic
990308881 5:54518944-54518966 CTTCTCGGGCAGGTGGGGCACGG - Exonic
994981013 5:106875295-106875317 GTGCTGGTGCAGGTGGATATTGG - Intergenic
998349089 5:141489297-141489319 GTCCTTGTGCTGCTGGGGCTGGG + Exonic
1000171616 5:158707999-158708021 GTGCTGGTGCAGGTGGGAGGTGG + Exonic
1000774242 5:165397697-165397719 GTGCAGGTGCAGGTGTGGTTTGG - Intergenic
1002445489 5:179287735-179287757 GTGCTCCTCCAGGAGGGGCCAGG + Intronic
1002998715 6:2311149-2311171 GTGCCCGTGCAAGTGTGGCATGG - Intergenic
1003261542 6:4521174-4521196 GTCCTGCTGCAGGTGGGGGTGGG - Intergenic
1005284628 6:24312126-24312148 GTTCTCTTGCAGGCGGGGGTGGG - Intronic
1005972132 6:30769684-30769706 GGGCCCGTGGAGGTGAGGCTGGG - Intergenic
1006445648 6:34078433-34078455 GGGCTCTGGCTGGTGGGGCTTGG - Intronic
1007284762 6:40739632-40739654 GTGCCCTTGCAGGATGGGCTAGG - Intergenic
1007594019 6:43040416-43040438 GTGCTCCTTCAGGTGGGCCTTGG - Exonic
1007925275 6:45644938-45644960 GTGCTAATGCAGGTGCTGCTGGG + Intronic
1013596024 6:111661908-111661930 GTGCTGGAGCAGGTGGAGCGAGG - Exonic
1014747116 6:125213574-125213596 GTGCTCCTGCATCAGGGGCTGGG - Intronic
1015172322 6:130267193-130267215 GTGCCCGTGCAAGTGTGGCATGG + Intronic
1018511791 6:164532326-164532348 GGGCACATGCAGGTGAGGCTGGG + Intergenic
1019174514 6:170153479-170153501 CGGCTCATGCAGGTGGGACTGGG - Intergenic
1019315057 7:380503-380525 GTCTTCGTGCAGGTGCAGCTCGG + Intergenic
1019322183 7:420815-420837 GTGCTCCTGGAGGAGGGCCTGGG - Intergenic
1019374854 7:683934-683956 GTGCACGTGGAGGTGGGCATTGG - Intronic
1019374881 7:684085-684107 GTGCACGTGGAGGTGGGCATTGG - Intronic
1019374898 7:684175-684197 GTGCACGTGGAGGTGGGCATTGG - Intronic
1019946188 7:4331177-4331199 ATGATGGTGCATGTGGGGCTGGG - Intergenic
1020208946 7:6143295-6143317 GTGCTGCTTCAGGTGTGGCTGGG + Intronic
1022468269 7:30665677-30665699 GGGCACGTGGGGGTGGGGCTGGG + Intronic
1022806097 7:33824086-33824108 GTGTGCATGCAGGTGGGACTAGG + Intergenic
1023998373 7:45175692-45175714 GTTCTGCTGCAGGTGGGGGTGGG + Intronic
1024002889 7:45202641-45202663 GAGCTGGTGCTGCTGGGGCTGGG - Intergenic
1029445851 7:100612540-100612562 GTGGCCGTCGAGGTGGGGCTCGG + Exonic
1029487537 7:100852693-100852715 GCGCGCGTGCTGGTGGGGGTGGG + Intronic
1030625402 7:111840661-111840683 GTGCTCATGCTGGTGTGGCTGGG + Intronic
1032074589 7:128830398-128830420 GTGCTCGGGAAGGGCGGGCTGGG - Exonic
1034492185 7:151399371-151399393 GGGGTCCTGAAGGTGGGGCTGGG - Intronic
1035296623 7:157871020-157871042 GTGCTGGTGCTGGGGGCGCTAGG + Intronic
1035566803 8:646710-646732 GTGCAGGTGCAGGGGAGGCTGGG - Intronic
1035580946 8:738660-738682 CTGCGCGCCCAGGTGGGGCTGGG + Intergenic
1043969631 8:86514842-86514864 GCGCTCGCGCACCTGGGGCTGGG + Intronic
1049381394 8:142318139-142318161 GTGCACGTGCAGGTGGCCTTGGG + Intronic
1049784677 8:144444642-144444664 GTTCTCGTGCGGGAGGAGCTGGG + Intergenic
1051612104 9:18971060-18971082 GGGCTGGTGCAGGTCGGACTGGG - Intronic
1053019120 9:34682711-34682733 GTCCTAGTGCAGAGGGGGCTGGG - Intergenic
1053310449 9:37014969-37014991 GGGCTCGTGCCTGTGGGGGTTGG - Intronic
1056295907 9:85192927-85192949 TTGCTCATCCAGGTTGGGCTTGG - Intergenic
1056696132 9:88855307-88855329 TTGCTGGTGTAGGTGGGGATGGG - Intergenic
1056814154 9:89789585-89789607 GTGCTTCTGCAGGCTGGGCTTGG + Intergenic
1057903941 9:98969980-98970002 GAGCTGGTTCAGGTGTGGCTTGG - Intronic
1058233555 9:102461499-102461521 GTGCTGTTGCTGGTGGGGCAGGG + Intergenic
1058974719 9:110115188-110115210 GTGCTGGTCCAGGGTGGGCTTGG + Intronic
1060792864 9:126497672-126497694 GTTCACGAGCAGGTGGGCCTTGG - Intronic
1061947709 9:133917957-133917979 GTGCTCGTGGAAGTGGCGATGGG - Intronic
1062014643 9:134284998-134285020 GTGTTTGTGCCGGTGGGTCTGGG + Intergenic
1062099856 9:134722372-134722394 ATGGTCGTGCAGGTGTGCCTGGG + Intronic
1062552593 9:137096714-137096736 CTGCTCGACCAGATGGGGCTCGG - Intronic
1185452647 X:290951-290973 GCGCTGGTGCAGGTGCGGCCGGG + Intronic
1190734110 X:53243927-53243949 ATGCTAGTGCAGGCGGGGCATGG + Intronic
1191917561 X:66219295-66219317 GTGCCCGTGCAAGTGTGGCATGG - Intronic
1193635359 X:83943719-83943741 GTGTGGGTGCTGGTGGGGCTTGG + Intergenic
1193717745 X:84951718-84951740 GTGCCCGTGCAAGTGCGGCATGG + Intergenic
1196422619 X:115538480-115538502 GTGCCCGTGCAAGTGTGGCATGG - Intergenic
1200393674 X:155969693-155969715 GTGCCCGTGCAAGTGTGGCATGG - Intergenic
1201556624 Y:15269768-15269790 GTGCCCTTGCAAGTGGGGCATGG + Intergenic