ID: 1084403174

View in Genome Browser
Species Human (GRCh38)
Location 11:68956449-68956471
Sequence CTTTAAGCAGACATAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084403174_1084403180 -7 Left 1084403174 11:68956449-68956471 CCCTCCTCTATGTCTGCTTAAAG No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403174_1084403179 -10 Left 1084403174 11:68956449-68956471 CCCTCCTCTATGTCTGCTTAAAG No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data
1084403174_1084403181 -4 Left 1084403174 11:68956449-68956471 CCCTCCTCTATGTCTGCTTAAAG No data
Right 1084403181 11:68956468-68956490 AAAGAAGAATTTCGGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084403174 Original CRISPR CTTTAAGCAGACATAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr