ID: 1084403179

View in Genome Browser
Species Human (GRCh38)
Location 11:68956462-68956484
Sequence CTGCTTAAAGAAGAATTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084403170_1084403179 -1 Left 1084403170 11:68956440-68956462 CCCACCTTCCCCTCCTCTATGTC No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data
1084403174_1084403179 -10 Left 1084403174 11:68956449-68956471 CCCTCCTCTATGTCTGCTTAAAG No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data
1084403173_1084403179 -9 Left 1084403173 11:68956448-68956470 CCCCTCCTCTATGTCTGCTTAAA No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data
1084403171_1084403179 -2 Left 1084403171 11:68956441-68956463 CCACCTTCCCCTCCTCTATGTCT No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data
1084403172_1084403179 -5 Left 1084403172 11:68956444-68956466 CCTTCCCCTCCTCTATGTCTGCT No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data
1084403169_1084403179 0 Left 1084403169 11:68956439-68956461 CCCCACCTTCCCCTCCTCTATGT No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data
1084403167_1084403179 2 Left 1084403167 11:68956437-68956459 CCCCCCACCTTCCCCTCCTCTAT No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data
1084403168_1084403179 1 Left 1084403168 11:68956438-68956460 CCCCCACCTTCCCCTCCTCTATG No data
Right 1084403179 11:68956462-68956484 CTGCTTAAAGAAGAATTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084403179 Original CRISPR CTGCTTAAAGAAGAATTTCG GGG Intergenic
No off target data available for this crispr