ID: 1084403180

View in Genome Browser
Species Human (GRCh38)
Location 11:68956465-68956487
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084403172_1084403180 -2 Left 1084403172 11:68956444-68956466 CCTTCCCCTCCTCTATGTCTGCT No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403175_1084403180 -8 Left 1084403175 11:68956450-68956472 CCTCCTCTATGTCTGCTTAAAGA No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403169_1084403180 3 Left 1084403169 11:68956439-68956461 CCCCACCTTCCCCTCCTCTATGT No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403168_1084403180 4 Left 1084403168 11:68956438-68956460 CCCCCACCTTCCCCTCCTCTATG No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403173_1084403180 -6 Left 1084403173 11:68956448-68956470 CCCCTCCTCTATGTCTGCTTAAA No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403170_1084403180 2 Left 1084403170 11:68956440-68956462 CCCACCTTCCCCTCCTCTATGTC No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403171_1084403180 1 Left 1084403171 11:68956441-68956463 CCACCTTCCCCTCCTCTATGTCT No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403174_1084403180 -7 Left 1084403174 11:68956449-68956471 CCCTCCTCTATGTCTGCTTAAAG No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data
1084403167_1084403180 5 Left 1084403167 11:68956437-68956459 CCCCCCACCTTCCCCTCCTCTAT No data
Right 1084403180 11:68956465-68956487 CTTAAAGAAGAATTTCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084403180 Original CRISPR CTTAAAGAAGAATTTCGGGG TGG Intergenic
No off target data available for this crispr