ID: 1084403705

View in Genome Browser
Species Human (GRCh38)
Location 11:68959374-68959396
Sequence TTTTTTTATCCCCAAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084403705_1084403710 10 Left 1084403705 11:68959374-68959396 CCTCTGTCTTGGGGATAAAAAAA No data
Right 1084403710 11:68959407-68959429 GGTAGAGCCCTGCACACAGCGGG No data
1084403705_1084403715 25 Left 1084403705 11:68959374-68959396 CCTCTGTCTTGGGGATAAAAAAA No data
Right 1084403715 11:68959422-68959444 ACAGCGGGAGCAGGGTGCTCTGG No data
1084403705_1084403713 17 Left 1084403705 11:68959374-68959396 CCTCTGTCTTGGGGATAAAAAAA No data
Right 1084403713 11:68959414-68959436 CCCTGCACACAGCGGGAGCAGGG No data
1084403705_1084403709 9 Left 1084403705 11:68959374-68959396 CCTCTGTCTTGGGGATAAAAAAA No data
Right 1084403709 11:68959406-68959428 GGGTAGAGCCCTGCACACAGCGG No data
1084403705_1084403711 16 Left 1084403705 11:68959374-68959396 CCTCTGTCTTGGGGATAAAAAAA No data
Right 1084403711 11:68959413-68959435 GCCCTGCACACAGCGGGAGCAGG No data
1084403705_1084403716 26 Left 1084403705 11:68959374-68959396 CCTCTGTCTTGGGGATAAAAAAA No data
Right 1084403716 11:68959423-68959445 CAGCGGGAGCAGGGTGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084403705 Original CRISPR TTTTTTTATCCCCAAGACAG AGG (reversed) Intergenic
No off target data available for this crispr