ID: 1084403713

View in Genome Browser
Species Human (GRCh38)
Location 11:68959414-68959436
Sequence CCCTGCACACAGCGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084403705_1084403713 17 Left 1084403705 11:68959374-68959396 CCTCTGTCTTGGGGATAAAAAAA No data
Right 1084403713 11:68959414-68959436 CCCTGCACACAGCGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084403713 Original CRISPR CCCTGCACACAGCGGGAGCA GGG Intergenic
No off target data available for this crispr