ID: 1084403895

View in Genome Browser
Species Human (GRCh38)
Location 11:68960142-68960164
Sequence AGCACAGATGGCCCTGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084403895_1084403901 11 Left 1084403895 11:68960142-68960164 CCCTGTCCAGGGCCATCTGTGCT No data
Right 1084403901 11:68960176-68960198 TGAGCACAGGCTGCCAGCTCTGG No data
1084403895_1084403900 -2 Left 1084403895 11:68960142-68960164 CCCTGTCCAGGGCCATCTGTGCT No data
Right 1084403900 11:68960163-68960185 CTGCTCAGATGGCTGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084403895 Original CRISPR AGCACAGATGGCCCTGGACA GGG (reversed) Intergenic
No off target data available for this crispr