ID: 1084405226

View in Genome Browser
Species Human (GRCh38)
Location 11:68968212-68968234
Sequence GCCACATATGTCCCCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084405221_1084405226 11 Left 1084405221 11:68968178-68968200 CCAGAGCATCCGAGAATGTCCTG No data
Right 1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG No data
1084405220_1084405226 17 Left 1084405220 11:68968172-68968194 CCATGGCCAGAGCATCCGAGAAT No data
Right 1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG No data
1084405216_1084405226 25 Left 1084405216 11:68968164-68968186 CCCTCTCCCCATGGCCAGAGCAT No data
Right 1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG No data
1084405219_1084405226 18 Left 1084405219 11:68968171-68968193 CCCATGGCCAGAGCATCCGAGAA No data
Right 1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG No data
1084405217_1084405226 24 Left 1084405217 11:68968165-68968187 CCTCTCCCCATGGCCAGAGCATC No data
Right 1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG No data
1084405224_1084405226 -8 Left 1084405224 11:68968197-68968219 CCTGGCGCATCCTTCGCCACATA No data
Right 1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG No data
1084405218_1084405226 19 Left 1084405218 11:68968170-68968192 CCCCATGGCCAGAGCATCCGAGA No data
Right 1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG No data
1084405223_1084405226 2 Left 1084405223 11:68968187-68968209 CCGAGAATGTCCTGGCGCATCCT No data
Right 1084405226 11:68968212-68968234 GCCACATATGTCCCCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084405226 Original CRISPR GCCACATATGTCCCCAGTCC TGG Intergenic
No off target data available for this crispr