ID: 1084406203

View in Genome Browser
Species Human (GRCh38)
Location 11:68975053-68975075
Sequence CAGATTGAAGACAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084406198_1084406203 -2 Left 1084406198 11:68975032-68975054 CCAGATTGGAAGACTTTTGGCCA No data
Right 1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG No data
1084406194_1084406203 23 Left 1084406194 11:68975007-68975029 CCAGAGGCAGGGTTTGAACTTTT No data
Right 1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084406203 Original CRISPR CAGATTGAAGACAGGGAAGA GGG Intergenic
No off target data available for this crispr