ID: 1084409152

View in Genome Browser
Species Human (GRCh38)
Location 11:68996561-68996583
Sequence AGCGATGCTTTGCACCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409152_1084409160 24 Left 1084409152 11:68996561-68996583 CCCACGGGGTGCAAAGCATCGCT No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409152 Original CRISPR AGCGATGCTTTGCACCCCGT GGG (reversed) Intergenic
No off target data available for this crispr