ID: 1084409155

View in Genome Browser
Species Human (GRCh38)
Location 11:68996590-68996612
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409155_1084409166 25 Left 1084409155 11:68996590-68996612 CCCCACGCTCTCCTGCCTTCACC No data
Right 1084409166 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
1084409155_1084409163 12 Left 1084409155 11:68996590-68996612 CCCCACGCTCTCCTGCCTTCACC No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409155_1084409160 -5 Left 1084409155 11:68996590-68996612 CCCCACGCTCTCCTGCCTTCACC No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409155 Original CRISPR GGTGAAGGCAGGAGAGCGTG GGG (reversed) Intergenic
No off target data available for this crispr