ID: 1084409157

View in Genome Browser
Species Human (GRCh38)
Location 11:68996592-68996614
Sequence TGGGTGAAGGCAGGAGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409157_1084409160 -7 Left 1084409157 11:68996592-68996614 CCACGCTCTCCTGCCTTCACCCA No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data
1084409157_1084409163 10 Left 1084409157 11:68996592-68996614 CCACGCTCTCCTGCCTTCACCCA No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409157_1084409166 23 Left 1084409157 11:68996592-68996614 CCACGCTCTCCTGCCTTCACCCA No data
Right 1084409166 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409157 Original CRISPR TGGGTGAAGGCAGGAGAGCG TGG (reversed) Intergenic
No off target data available for this crispr