ID: 1084409158

View in Genome Browser
Species Human (GRCh38)
Location 11:68996601-68996623
Sequence TTTGCAATCTGGGTGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409158_1084409167 22 Left 1084409158 11:68996601-68996623 CCTGCCTTCACCCAGATTGCAAA No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data
1084409158_1084409168 28 Left 1084409158 11:68996601-68996623 CCTGCCTTCACCCAGATTGCAAA No data
Right 1084409168 11:68996652-68996674 AGTGTGTGGTCCCTCGGTGAAGG No data
1084409158_1084409163 1 Left 1084409158 11:68996601-68996623 CCTGCCTTCACCCAGATTGCAAA No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409158_1084409166 14 Left 1084409158 11:68996601-68996623 CCTGCCTTCACCCAGATTGCAAA No data
Right 1084409166 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409158 Original CRISPR TTTGCAATCTGGGTGAAGGC AGG (reversed) Intergenic