ID: 1084409159

View in Genome Browser
Species Human (GRCh38)
Location 11:68996605-68996627
Sequence GTTTTTTGCAATCTGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409159_1084409168 24 Left 1084409159 11:68996605-68996627 CCTTCACCCAGATTGCAAAAAAC No data
Right 1084409168 11:68996652-68996674 AGTGTGTGGTCCCTCGGTGAAGG No data
1084409159_1084409167 18 Left 1084409159 11:68996605-68996627 CCTTCACCCAGATTGCAAAAAAC No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data
1084409159_1084409166 10 Left 1084409159 11:68996605-68996627 CCTTCACCCAGATTGCAAAAAAC No data
Right 1084409166 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
1084409159_1084409163 -3 Left 1084409159 11:68996605-68996627 CCTTCACCCAGATTGCAAAAAAC No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409159_1084409169 27 Left 1084409159 11:68996605-68996627 CCTTCACCCAGATTGCAAAAAAC No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409159 Original CRISPR GTTTTTTGCAATCTGGGTGA AGG (reversed) Intergenic
No off target data available for this crispr