ID: 1084409160

View in Genome Browser
Species Human (GRCh38)
Location 11:68996608-68996630
Sequence TCACCCAGATTGCAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409154_1084409160 -4 Left 1084409154 11:68996589-68996611 CCCCCACGCTCTCCTGCCTTCAC No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data
1084409156_1084409160 -6 Left 1084409156 11:68996591-68996613 CCCACGCTCTCCTGCCTTCACCC No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data
1084409157_1084409160 -7 Left 1084409157 11:68996592-68996614 CCACGCTCTCCTGCCTTCACCCA No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data
1084409152_1084409160 24 Left 1084409152 11:68996561-68996583 CCCACGGGGTGCAAAGCATCGCT No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data
1084409155_1084409160 -5 Left 1084409155 11:68996590-68996612 CCCCACGCTCTCCTGCCTTCACC No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data
1084409153_1084409160 23 Left 1084409153 11:68996562-68996584 CCACGGGGTGCAAAGCATCGCTT No data
Right 1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409160 Original CRISPR TCACCCAGATTGCAAAAAAC AGG Intergenic
No off target data available for this crispr