ID: 1084409161

View in Genome Browser
Species Human (GRCh38)
Location 11:68996611-68996633
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409161_1084409170 25 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409170 11:68996659-68996681 GGTCCCTCGGTGAAGGTGGCTGG No data
1084409161_1084409163 -9 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409161_1084409169 21 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data
1084409161_1084409166 4 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409166 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
1084409161_1084409167 12 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data
1084409161_1084409168 18 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409168 11:68996652-68996674 AGTGTGTGGTCCCTCGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409161 Original CRISPR AGGCCTGTTTTTTGCAATCT GGG (reversed) Intergenic