ID: 1084409162

View in Genome Browser
Species Human (GRCh38)
Location 11:68996612-68996634
Sequence GAGGCCTGTTTTTTGCAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409162_1084409166 3 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409166 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
1084409162_1084409167 11 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data
1084409162_1084409169 20 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data
1084409162_1084409163 -10 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409162_1084409168 17 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409168 11:68996652-68996674 AGTGTGTGGTCCCTCGGTGAAGG No data
1084409162_1084409170 24 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409170 11:68996659-68996681 GGTCCCTCGGTGAAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409162 Original CRISPR GAGGCCTGTTTTTTGCAATC TGG (reversed) Intergenic