ID: 1084409163

View in Genome Browser
Species Human (GRCh38)
Location 11:68996625-68996647
Sequence AACAGGCCTCTCACCTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409156_1084409163 11 Left 1084409156 11:68996591-68996613 CCCACGCTCTCCTGCCTTCACCC No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409155_1084409163 12 Left 1084409155 11:68996590-68996612 CCCCACGCTCTCCTGCCTTCACC No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409157_1084409163 10 Left 1084409157 11:68996592-68996614 CCACGCTCTCCTGCCTTCACCCA No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409162_1084409163 -10 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409159_1084409163 -3 Left 1084409159 11:68996605-68996627 CCTTCACCCAGATTGCAAAAAAC No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409154_1084409163 13 Left 1084409154 11:68996589-68996611 CCCCCACGCTCTCCTGCCTTCAC No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409158_1084409163 1 Left 1084409158 11:68996601-68996623 CCTGCCTTCACCCAGATTGCAAA No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data
1084409161_1084409163 -9 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409163 11:68996625-68996647 AACAGGCCTCTCACCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409163 Original CRISPR AACAGGCCTCTCACCTGTCT TGG Intergenic
No off target data available for this crispr