ID: 1084409164

View in Genome Browser
Species Human (GRCh38)
Location 11:68996631-68996653
Sequence CTGCATCCAAGACAGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409164_1084409168 -2 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409168 11:68996652-68996674 AGTGTGTGGTCCCTCGGTGAAGG No data
1084409164_1084409173 27 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409173 11:68996681-68996703 GTGCCTGCCCACTCCAGTGCTGG No data
1084409164_1084409170 5 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409170 11:68996659-68996681 GGTCCCTCGGTGAAGGTGGCTGG No data
1084409164_1084409175 30 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409175 11:68996684-68996706 CCTGCCCACTCCAGTGCTGGAGG No data
1084409164_1084409169 1 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data
1084409164_1084409167 -8 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409164 Original CRISPR CTGCATCCAAGACAGGTGAG AGG (reversed) Intergenic