ID: 1084409165

View in Genome Browser
Species Human (GRCh38)
Location 11:68996638-68996660
Sequence CCACACACTGCATCCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409165_1084409170 -2 Left 1084409165 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
Right 1084409170 11:68996659-68996681 GGTCCCTCGGTGAAGGTGGCTGG No data
1084409165_1084409175 23 Left 1084409165 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
Right 1084409175 11:68996684-68996706 CCTGCCCACTCCAGTGCTGGAGG No data
1084409165_1084409168 -9 Left 1084409165 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
Right 1084409168 11:68996652-68996674 AGTGTGTGGTCCCTCGGTGAAGG No data
1084409165_1084409173 20 Left 1084409165 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
Right 1084409173 11:68996681-68996703 GTGCCTGCCCACTCCAGTGCTGG No data
1084409165_1084409169 -6 Left 1084409165 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409165 Original CRISPR CCACACACTGCATCCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr