ID: 1084409167

View in Genome Browser
Species Human (GRCh38)
Location 11:68996646-68996668
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409164_1084409167 -8 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data
1084409158_1084409167 22 Left 1084409158 11:68996601-68996623 CCTGCCTTCACCCAGATTGCAAA No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data
1084409159_1084409167 18 Left 1084409159 11:68996605-68996627 CCTTCACCCAGATTGCAAAAAAC No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data
1084409162_1084409167 11 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data
1084409161_1084409167 12 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409167 11:68996646-68996668 GGATGCAGTGTGTGGTCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409167 Original CRISPR GGATGCAGTGTGTGGTCCCT CGG Intergenic