ID: 1084409169

View in Genome Browser
Species Human (GRCh38)
Location 11:68996655-68996677
Sequence GTGTGGTCCCTCGGTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409159_1084409169 27 Left 1084409159 11:68996605-68996627 CCTTCACCCAGATTGCAAAAAAC No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data
1084409161_1084409169 21 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data
1084409165_1084409169 -6 Left 1084409165 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data
1084409164_1084409169 1 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data
1084409162_1084409169 20 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409169 11:68996655-68996677 GTGTGGTCCCTCGGTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409169 Original CRISPR GTGTGGTCCCTCGGTGAAGG TGG Intergenic
No off target data available for this crispr