ID: 1084409170 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:68996659-68996681 |
| Sequence | GGTCCCTCGGTGAAGGTGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1084409164_1084409170 | 5 | Left | 1084409164 | 11:68996631-68996653 | CCTCTCACCTGTCTTGGATGCAG | No data | ||
| Right | 1084409170 | 11:68996659-68996681 | GGTCCCTCGGTGAAGGTGGCTGG | No data | ||||
| 1084409162_1084409170 | 24 | Left | 1084409162 | 11:68996612-68996634 | CCAGATTGCAAAAAACAGGCCTC | No data | ||
| Right | 1084409170 | 11:68996659-68996681 | GGTCCCTCGGTGAAGGTGGCTGG | No data | ||||
| 1084409161_1084409170 | 25 | Left | 1084409161 | 11:68996611-68996633 | CCCAGATTGCAAAAAACAGGCCT | No data | ||
| Right | 1084409170 | 11:68996659-68996681 | GGTCCCTCGGTGAAGGTGGCTGG | No data | ||||
| 1084409165_1084409170 | -2 | Left | 1084409165 | 11:68996638-68996660 | CCTGTCTTGGATGCAGTGTGTGG | No data | ||
| Right | 1084409170 | 11:68996659-68996681 | GGTCCCTCGGTGAAGGTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1084409170 | Original CRISPR | GGTCCCTCGGTGAAGGTGGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||