ID: 1084409170

View in Genome Browser
Species Human (GRCh38)
Location 11:68996659-68996681
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409165_1084409170 -2 Left 1084409165 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
Right 1084409170 11:68996659-68996681 GGTCCCTCGGTGAAGGTGGCTGG No data
1084409162_1084409170 24 Left 1084409162 11:68996612-68996634 CCAGATTGCAAAAAACAGGCCTC No data
Right 1084409170 11:68996659-68996681 GGTCCCTCGGTGAAGGTGGCTGG No data
1084409164_1084409170 5 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409170 11:68996659-68996681 GGTCCCTCGGTGAAGGTGGCTGG No data
1084409161_1084409170 25 Left 1084409161 11:68996611-68996633 CCCAGATTGCAAAAAACAGGCCT No data
Right 1084409170 11:68996659-68996681 GGTCCCTCGGTGAAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409170 Original CRISPR GGTCCCTCGGTGAAGGTGGC TGG Intergenic