ID: 1084409175

View in Genome Browser
Species Human (GRCh38)
Location 11:68996684-68996706
Sequence CCTGCCCACTCCAGTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409172_1084409175 -2 Left 1084409172 11:68996663-68996685 CCTCGGTGAAGGTGGCTGGTGCC No data
Right 1084409175 11:68996684-68996706 CCTGCCCACTCCAGTGCTGGAGG No data
1084409171_1084409175 -1 Left 1084409171 11:68996662-68996684 CCCTCGGTGAAGGTGGCTGGTGC No data
Right 1084409175 11:68996684-68996706 CCTGCCCACTCCAGTGCTGGAGG No data
1084409165_1084409175 23 Left 1084409165 11:68996638-68996660 CCTGTCTTGGATGCAGTGTGTGG No data
Right 1084409175 11:68996684-68996706 CCTGCCCACTCCAGTGCTGGAGG No data
1084409164_1084409175 30 Left 1084409164 11:68996631-68996653 CCTCTCACCTGTCTTGGATGCAG No data
Right 1084409175 11:68996684-68996706 CCTGCCCACTCCAGTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409175 Original CRISPR CCTGCCCACTCCAGTGCTGG AGG Intergenic