ID: 1084409220

View in Genome Browser
Species Human (GRCh38)
Location 11:68996855-68996877
Sequence CCCTCTGAGCAGTGGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409212_1084409220 7 Left 1084409212 11:68996825-68996847 CCAGGATCCCCTGATGATCTTCG No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data
1084409209_1084409220 14 Left 1084409209 11:68996818-68996840 CCTGTCCCCAGGATCCCCTGATG No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data
1084409214_1084409220 0 Left 1084409214 11:68996832-68996854 CCCCTGATGATCTTCGCTAGGTT No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data
1084409215_1084409220 -1 Left 1084409215 11:68996833-68996855 CCCTGATGATCTTCGCTAGGTTC No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data
1084409216_1084409220 -2 Left 1084409216 11:68996834-68996856 CCTGATGATCTTCGCTAGGTTCC No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data
1084409206_1084409220 30 Left 1084409206 11:68996802-68996824 CCCAGGCTCAGAGGAGCCTGTCC No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data
1084409211_1084409220 8 Left 1084409211 11:68996824-68996846 CCCAGGATCCCCTGATGATCTTC No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data
1084409210_1084409220 9 Left 1084409210 11:68996823-68996845 CCCCAGGATCCCCTGATGATCTT No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data
1084409207_1084409220 29 Left 1084409207 11:68996803-68996825 CCAGGCTCAGAGGAGCCTGTCCC No data
Right 1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409220 Original CRISPR CCCTCTGAGCAGTGGGAAGC CGG Intergenic
No off target data available for this crispr