ID: 1084409322

View in Genome Browser
Species Human (GRCh38)
Location 11:68997254-68997276
Sequence CTGCCTACGGAGGGATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409308_1084409322 29 Left 1084409308 11:68997202-68997224 CCCCAACTGCCTGCCTGGGGAGA No data
Right 1084409322 11:68997254-68997276 CTGCCTACGGAGGGATGGGGAGG No data
1084409312_1084409322 20 Left 1084409312 11:68997211-68997233 CCTGCCTGGGGAGATGCTCTGGC No data
Right 1084409322 11:68997254-68997276 CTGCCTACGGAGGGATGGGGAGG No data
1084409310_1084409322 27 Left 1084409310 11:68997204-68997226 CCAACTGCCTGCCTGGGGAGATG No data
Right 1084409322 11:68997254-68997276 CTGCCTACGGAGGGATGGGGAGG No data
1084409313_1084409322 16 Left 1084409313 11:68997215-68997237 CCTGGGGAGATGCTCTGGCTAAT No data
Right 1084409322 11:68997254-68997276 CTGCCTACGGAGGGATGGGGAGG No data
1084409307_1084409322 30 Left 1084409307 11:68997201-68997223 CCCCCAACTGCCTGCCTGGGGAG No data
Right 1084409322 11:68997254-68997276 CTGCCTACGGAGGGATGGGGAGG No data
1084409309_1084409322 28 Left 1084409309 11:68997203-68997225 CCCAACTGCCTGCCTGGGGAGAT No data
Right 1084409322 11:68997254-68997276 CTGCCTACGGAGGGATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409322 Original CRISPR CTGCCTACGGAGGGATGGGG AGG Intergenic
No off target data available for this crispr