ID: 1084409834

View in Genome Browser
Species Human (GRCh38)
Location 11:69000396-69000418
Sequence CTTCAGACACAGCTGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084409834_1084409838 3 Left 1084409834 11:69000396-69000418 CCTGGATCCAGCTGTGTCTGAAG No data
Right 1084409838 11:69000422-69000444 GAATCACTTCTGGAACTTTCTGG No data
1084409834_1084409839 4 Left 1084409834 11:69000396-69000418 CCTGGATCCAGCTGTGTCTGAAG No data
Right 1084409839 11:69000423-69000445 AATCACTTCTGGAACTTTCTGGG No data
1084409834_1084409836 -7 Left 1084409834 11:69000396-69000418 CCTGGATCCAGCTGTGTCTGAAG No data
Right 1084409836 11:69000412-69000434 TCTGAAGCCAGAATCACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084409834 Original CRISPR CTTCAGACACAGCTGGATCC AGG (reversed) Intergenic
No off target data available for this crispr