ID: 1084411568

View in Genome Browser
Species Human (GRCh38)
Location 11:69009065-69009087
Sequence CGCTGTGGAGTGGCGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 134}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084411568_1084411585 24 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411585 11:69009112-69009134 GCCCAAGGCCCAAGGGCGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 180
1084411568_1084411582 17 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411582 11:69009105-69009127 GGAGAGGGCCCAAGGCCCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 223
1084411568_1084411587 25 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411587 11:69009113-69009135 CCCAAGGCCCAAGGGCGTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 171
1084411568_1084411584 23 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411584 11:69009111-69009133 GGCCCAAGGCCCAAGGGCGTGGG 0: 1
1: 0
2: 0
3: 16
4: 147
1084411568_1084411581 16 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411581 11:69009104-69009126 GGGAGAGGGCCCAAGGCCCAAGG 0: 1
1: 1
2: 5
3: 55
4: 423
1084411568_1084411577 -4 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411577 11:69009084-69009106 AGCGGTCACTACGGGGAAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 51
1084411568_1084411583 22 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411583 11:69009110-69009132 GGGCCCAAGGCCCAAGGGCGTGG 0: 1
1: 0
2: 0
3: 18
4: 251
1084411568_1084411580 9 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411580 11:69009097-69009119 GGGAAGAGGGAGAGGGCCCAAGG 0: 1
1: 1
2: 12
3: 92
4: 1049
1084411568_1084411578 1 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411578 11:69009089-69009111 TCACTACGGGGAAGAGGGAGAGG 0: 1
1: 0
2: 2
3: 29
4: 225
1084411568_1084411576 -5 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411576 11:69009083-69009105 CAGCGGTCACTACGGGGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 62
1084411568_1084411579 2 Left 1084411568 11:69009065-69009087 CCTGCGGCCGCCACTCCACAGCG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1084411579 11:69009090-69009112 CACTACGGGGAAGAGGGAGAGGG 0: 1
1: 0
2: 4
3: 14
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084411568 Original CRISPR CGCTGTGGAGTGGCGGCCGC AGG (reversed) Intronic
900254830 1:1692691-1692713 CACTGAGGAGCGGCGCCCGCGGG - Intronic
900263581 1:1745966-1745988 CACTGAGGAGCGGCGCCCGCGGG - Exonic
900316432 1:2059484-2059506 GACTGTTGAGTGGCAGCCGCAGG + Intronic
900514190 1:3073590-3073612 CGCGGTGCAGCGGCGGCCGCGGG + Intronic
901059642 1:6466089-6466111 GGCTATGGAGCAGCGGCCGCGGG - Exonic
903907536 1:26696951-26696973 CGCTGCAGAGCGGCGGCGGCGGG + Exonic
905879815 1:41456097-41456119 GGCTGTGGAGTGGCGGGGCCAGG + Intergenic
911188602 1:94926966-94926988 CCCCGAGGAGTGGCCGCCGCGGG + Exonic
914459250 1:147867594-147867616 TGTTGTGGAGTGGGGGCCTCGGG + Intergenic
915326695 1:155084567-155084589 CGGGGTGGACTGGCAGCCGCAGG + Intronic
920298140 1:204972165-204972187 ATCTGTGGAGTGGCGCCTGCAGG + Intronic
922416486 1:225427624-225427646 GGCTGTGGAGCGGCGGCGGCAGG - Intronic
923051480 1:230393853-230393875 GGCTGTGGACTGGCGGGCCCCGG - Intronic
923324192 1:232866283-232866305 CAATGTTGAGTGGCGGCTGCTGG - Intergenic
923954323 1:238997558-238997580 TGCTGAGCAGTGGCGGCGGCAGG + Intergenic
1067015447 10:42754228-42754250 CGCTGTAGACTCGCGGCGGCAGG + Intergenic
1067045670 10:42983846-42983868 CTCTGTGGAGTGGGGGCTGGGGG + Intergenic
1075090373 10:119441101-119441123 CCCTGTGGAGGGGCGGTCGGAGG + Intronic
1075313596 10:121434286-121434308 AGCTGTGGAGTGTGAGCCGCTGG - Intergenic
1076096082 10:127736229-127736251 CGCTGTGGGGTGGCGGAGGATGG - Intergenic
1076114698 10:127887066-127887088 CGCTGTGGAGGTGCAGCCGTTGG + Intronic
1076344358 10:129770327-129770349 CCCTGTGGAGTGGCGGACTCTGG + Intergenic
1077495801 11:2885996-2886018 CGCGGCTGATTGGCGGCCGCGGG + Intergenic
1083460076 11:62805343-62805365 CGCTGTGGCATGGCGGACGAGGG - Exonic
1084411568 11:69009065-69009087 CGCTGTGGAGTGGCGGCCGCAGG - Intronic
1089731692 11:120523362-120523384 AGCTGTGGGGTGGCGGCTGCTGG + Intronic
1092743170 12:11649562-11649584 CGCGGGGGAGGGGCGGCCGCGGG - Intergenic
1095907328 12:47391646-47391668 AGGTGGGGAGTGGCGGCCACAGG - Intergenic
1096498258 12:52051020-52051042 CGCTGTAGAGACGCGGCCGCGGG - Intronic
1103484494 12:121273795-121273817 CAGTGTGGAGTGTGGGCCGCTGG - Intronic
1104035044 12:125092147-125092169 GGCTGGGGAGTGGGGGCCCCAGG - Intronic
1105015379 12:132783498-132783520 GGCTGGGGAGTGGGGGGCGCCGG + Intronic
1105239202 13:18595474-18595496 GTCTATGGAGTGGCGGCTGCAGG + Intergenic
1106698317 13:32202436-32202458 CGCTGTAGAGGGGTGGCAGCGGG - Exonic
1122275144 14:100587270-100587292 CCATGTGGACTGGCGGTCGCCGG - Intronic
1122306964 14:100772612-100772634 TTCTGTGGAGGGACGGCCGCAGG - Intergenic
1122986300 14:105213151-105213173 TGCAGTGGAGTGGGGGCCTCTGG + Intronic
1123113473 14:105883470-105883492 CACTGTGGAGTGGATGCTGCTGG + Intergenic
1128714015 15:69893831-69893853 AGCTGTGAAGTGGAGGCTGCCGG - Intergenic
1129382815 15:75178576-75178598 CGGGGTGGAGTCGCGGCCACCGG - Intergenic
1133216169 16:4293815-4293837 CACTGTGGAGTGGGGACCGGGGG + Intergenic
1133784237 16:8963011-8963033 CGCGGGCGAGGGGCGGCCGCCGG - Intronic
1133809343 16:9149163-9149185 CGCTGCGGAGAGGCGTCTGCAGG - Intergenic
1140457727 16:75114643-75114665 CTCTGTGGCATGGCGGCCACCGG - Exonic
1142206240 16:88784579-88784601 CGCTGCGGAGAGGAGGCCGCCGG - Intronic
1142957679 17:3532494-3532516 TGCAGTGGCGTGGCGGCCGGAGG - Intronic
1144959181 17:19035277-19035299 AGCTGTGGTGTGGCAGCCTCTGG - Intronic
1144975978 17:19139247-19139269 AGCTGTGGTGTGGCAGCCTCTGG + Intronic
1146273609 17:31500258-31500280 CGCTGTGGAGTGGCGGGGGTGGG + Intronic
1146398510 17:32486814-32486836 CGCCGGGGAGTCGCGGCCGTTGG - Exonic
1146442909 17:32912747-32912769 CGCTGGGGTGTGGCAGCCACTGG - Intergenic
1148215242 17:45830595-45830617 GCCTGGGCAGTGGCGGCCGCCGG + Intronic
1148909752 17:50935129-50935151 CGCTGTGGTGTGGCGGGGGAGGG - Intergenic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1151565072 17:74893222-74893244 CGGAGTGGACTGGCGGCGGCAGG - Intronic
1152304686 17:79513683-79513705 CACTGTGGAGTGGAGGACACTGG - Intronic
1152446558 17:80348169-80348191 CGCAGCGGAGTGGCTGTCGCAGG + Exonic
1152697579 17:81804546-81804568 CGCTGCAGTGTGGCCGCCGCAGG - Intronic
1152786256 17:82249498-82249520 GGCTGTGGAAGGGAGGCCGCGGG + Exonic
1152809473 17:82374771-82374793 CGCTGCGGTGCTGCGGCCGCTGG + Exonic
1160224834 18:77004703-77004725 CGCTGCAGGGTGGCGGCCGCTGG + Intronic
1160994425 19:1876092-1876114 CGGTGGTAAGTGGCGGCCGCTGG - Intergenic
1161018701 19:1997495-1997517 GGCCGTGGGGTGGCGGCCACGGG - Intronic
1161138833 19:2636346-2636368 AGCTGGGGAGTGGCAGCCCCAGG + Intronic
1161979399 19:7622724-7622746 GGCTGTGGGGTGGGGGCTGCAGG - Intronic
1162440272 19:10688214-10688236 GGCTGAGGAGAGGCGGCTGCTGG + Intronic
1162777917 19:12990679-12990701 CTCGGTGGCGTGGCGGCCTCAGG + Intergenic
1164639361 19:29812632-29812654 CGTGGGGGAGGGGCGGCCGCGGG + Intronic
1164658545 19:29942331-29942353 CGCTGCGGGGCGGCGGCGGCGGG + Exonic
1166141156 19:40806128-40806150 GGCTGTGGAGTGGAGCCCCCTGG - Intronic
1166876526 19:45901343-45901365 GGCTGTGAAGAGGGGGCCGCAGG + Exonic
1202693077 1_KI270712v1_random:104991-105013 CGCGGCGGAGAGGCGGCCGGCGG + Intergenic
926170605 2:10550556-10550578 CCCTGTGGAGAGGAGGCCCCAGG + Intergenic
927576561 2:24206443-24206465 CCCTGTGGGGTGGAGGCCACAGG + Intronic
931614706 2:64144245-64144267 CGCTGAGGAGCCGCGGACGCAGG + Exonic
934119649 2:88827406-88827428 TGCTGTGGAGGGGCTGTCGCTGG - Intergenic
936032060 2:109080301-109080323 GGCTGGGAAGTGGCGGCAGCAGG + Intergenic
937203777 2:120223186-120223208 CGCTGGGGTGTGGCGCGCGCGGG + Exonic
937906252 2:127054304-127054326 CCCTGCGGGGTGGCGGCCACGGG - Intronic
943739462 2:191395615-191395637 CGCCCTGGAGTGGAGGCTGCTGG - Intronic
947588208 2:231370081-231370103 CGCTGTGGAGCCGGGGCGGCTGG - Intronic
948696879 2:239737261-239737283 CGTTGTGTGGTGGCGGCAGCGGG - Intergenic
949032237 2:241802613-241802635 TGCTGTGGGGTGGGGGCTGCGGG + Intronic
1170719292 20:18861356-18861378 TGTTGTGGAGTGGCGGTGGCGGG - Intergenic
1172387930 20:34547093-34547115 CTCTGTGGAGTGAGGGCAGCAGG + Intronic
1173104823 20:40123930-40123952 GGTTGTGCAGTGGGGGCCGCTGG - Intergenic
1175828729 20:61950870-61950892 GGCTGTGGAGGGGCGGTTGCAGG - Intergenic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1178561528 21:33642969-33642991 GGCCGTGGGGTGGCGGCCGCGGG + Intronic
1179819077 21:43925910-43925932 CTCTCTGGTGTGGTGGCCGCCGG + Intronic
1181695156 22:24589264-24589286 AGCTGTGGGGTGGAGGCTGCAGG + Intronic
1183264527 22:36817185-36817207 CGCTGAGCAGCGCCGGCCGCCGG + Intronic
1183490860 22:38114948-38114970 CCCTGTGGCGTGGCGGGCGGTGG - Intronic
1184035052 22:41914281-41914303 CGCTGCGGTGTCGCGGGCGCGGG + Exonic
1184236559 22:43186285-43186307 CGCTTTGGAGTGGAGGAGGCAGG + Intronic
1184566590 22:45295665-45295687 CCCTGTCCAGTGGCGGCCCCCGG - Exonic
1184773988 22:46614226-46614248 CGCTGTGCAATGATGGCCGCTGG + Intronic
953694395 3:45146324-45146346 CGGTGGGGAGCGGCGGCCCCAGG + Exonic
954265883 3:49470112-49470134 CGCTGCGGAGCGGCCGACGCAGG + Exonic
954367682 3:50155073-50155095 CGCTCTGGTCTCGCGGCCGCCGG - Intronic
962198029 3:133380157-133380179 CGCTGTGGTGGGGCGGCTGGTGG - Exonic
965810976 3:172591793-172591815 CTCTGTGGAGTGGAGCCCCCAGG - Intergenic
967104368 3:186243442-186243464 CGGTGTGGAGTGGGGGCCGCAGG - Intronic
968323374 3:197791270-197791292 GGCTGGGAAATGGCGGCCGCGGG + Exonic
968534094 4:1113003-1113025 CACCGGGGAGTGGGGGCCGCGGG - Intronic
969649911 4:8459907-8459929 TGTTGTGTAGTGGCCGCCGCTGG + Intronic
975574521 4:75849581-75849603 CGCAGAGCAGTGGAGGCCGCCGG + Intergenic
976063056 4:81153466-81153488 GGCTTTGGAGTGGAGGCCACAGG - Intronic
981782666 4:148444881-148444903 CGCTGCGGAGCGGCGGGCGCGGG - Intergenic
984747927 4:183241013-183241035 CCCTGTGGAGTGGAGACTGCAGG - Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
987296232 5:16554352-16554374 TGCTGTGGAGAGGCAGGCGCTGG - Intronic
992105824 5:73448363-73448385 AGCTGTGGCGCGGCGGCGGCGGG + Intergenic
993901204 5:93585082-93585104 CGCTGCGGGGTTGGGGCCGCCGG - Exonic
997485301 5:134226066-134226088 CTCTCTGTAATGGCGGCCGCCGG + Exonic
997737985 5:136228529-136228551 TGCCGTGCAGTGGCGGCTGCTGG + Intronic
999427668 5:151501443-151501465 CGCTGTGGAGTAGCAGCCAGAGG + Intergenic
999427911 5:151503628-151503650 CGCTGTGGAGTAGCAGCCAGAGG + Intergenic
1002784077 6:388301-388323 CCCTGTGAAGTGGAGGCCGGCGG - Intergenic
1003206530 6:4018278-4018300 TGGTGTGGTGTGGCGGCGGCAGG + Intergenic
1005871248 6:29975611-29975633 GGCTGAGGAGTGGCGGCAACCGG + Intergenic
1016447727 6:144150419-144150441 CGCTGGGGCGCGGCGGCAGCCGG - Intergenic
1017124411 6:151052019-151052041 CGCAGTGGAGTGGAAGTCGCCGG + Intronic
1017889586 6:158627575-158627597 AGCTGTGGGGTGGCTGCCCCAGG + Intronic
1018679668 6:166253470-166253492 CTCCCTGGGGTGGCGGCCGCCGG - Intergenic
1019738487 7:2661723-2661745 CGCGGTCTAGTGGCTGCCGCTGG - Exonic
1019863611 7:3684063-3684085 CGCTGTGGGGTGGTGGTGGCAGG + Intronic
1020106247 7:5423538-5423560 CGGAGGGGAGCGGCGGCCGCGGG - Exonic
1021814654 7:24435458-24435480 AGATGTGGAGTGGCAGCCGTGGG + Intergenic
1024972878 7:55086720-55086742 AGCTGTGATGTGGCGGCAGCTGG + Intronic
1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG + Exonic
1034393151 7:150801180-150801202 GACTGTGGAGGGGAGGCCGCAGG + Exonic
1039463159 8:37762737-37762759 GGCTGTGGCGCGGCGGCCGCGGG + Exonic
1042170598 8:65987282-65987304 CGCTGTGGAGTGGCGAAGTCTGG - Intergenic
1045231402 8:100310158-100310180 CGCTGGGGCGGGGCGGCCGGGGG - Intronic
1047998529 8:130358425-130358447 CGCTGAGGAGCTGCCGCCGCCGG - Intronic
1049203307 8:141352072-141352094 GGCTGTGGAGGGGCGGGCCCAGG - Intergenic
1049354663 8:142181853-142181875 CACGGTGGAGGGGCGGCCACGGG - Intergenic
1049444351 8:142623234-142623256 GGCTGAGGACTGGCGGCCTCAGG - Intergenic
1049541485 8:143211141-143211163 CCCTGTGGAGGGGAGGCGGCAGG + Intergenic
1061262634 9:129488542-129488564 GGGCGTGGAGAGGCGGCCGCGGG - Intergenic
1061290928 9:129649874-129649896 AGCTCTGGGGTGGGGGCCGCTGG + Intergenic
1062033473 9:134372386-134372408 TGGTGTGGAGTGGGGGCCGCAGG + Intronic
1062098232 9:134713703-134713725 CAGTGTGGTGTGGCGGCCACAGG + Intronic
1062646384 9:137550661-137550683 CGCTGGGGAGTGGGTGCAGCTGG + Intergenic
1062646405 9:137550714-137550736 CGCTGGGGAGTGGGTGCAGCTGG + Intergenic
1062646424 9:137550767-137550789 CGCTGGGGAGTGGGTGCAGCTGG + Intergenic
1191870120 X:65738596-65738618 GGCTGTGGAGTGGCAGCAGAAGG + Exonic
1193601064 X:83508784-83508806 CTCTGTGCAGAGGCGGCAGCTGG - Exonic
1196687933 X:118528358-118528380 GGCTGGGGAGTGGCGGCGGATGG + Intronic