ID: 1084413935

View in Genome Browser
Species Human (GRCh38)
Location 11:69019625-69019647
Sequence GCTTCCCGCCAGGCCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084413935_1084413938 -8 Left 1084413935 11:69019625-69019647 CCCTCAGGGGCCTGGCGGGAAGC No data
Right 1084413938 11:69019640-69019662 CGGGAAGCTCACTCCTGCTTTGG No data
1084413935_1084413940 -6 Left 1084413935 11:69019625-69019647 CCCTCAGGGGCCTGGCGGGAAGC No data
Right 1084413940 11:69019642-69019664 GGAAGCTCACTCCTGCTTTGGGG No data
1084413935_1084413944 16 Left 1084413935 11:69019625-69019647 CCCTCAGGGGCCTGGCGGGAAGC No data
Right 1084413944 11:69019664-69019686 GCAGCAAGAGAGAGGGAAACAGG No data
1084413935_1084413942 8 Left 1084413935 11:69019625-69019647 CCCTCAGGGGCCTGGCGGGAAGC No data
Right 1084413942 11:69019656-69019678 GCTTTGGGGCAGCAAGAGAGAGG No data
1084413935_1084413943 9 Left 1084413935 11:69019625-69019647 CCCTCAGGGGCCTGGCGGGAAGC No data
Right 1084413943 11:69019657-69019679 CTTTGGGGCAGCAAGAGAGAGGG No data
1084413935_1084413939 -7 Left 1084413935 11:69019625-69019647 CCCTCAGGGGCCTGGCGGGAAGC No data
Right 1084413939 11:69019641-69019663 GGGAAGCTCACTCCTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084413935 Original CRISPR GCTTCCCGCCAGGCCCCTGA GGG (reversed) Intergenic
No off target data available for this crispr