ID: 1084415921

View in Genome Browser
Species Human (GRCh38)
Location 11:69032912-69032934
Sequence GCTGGGGTTCCTGGTTGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084415910_1084415921 -3 Left 1084415910 11:69032892-69032914 CCCCTGGCCCACCGTGGACTGCT No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415916_1084415921 -10 Left 1084415916 11:69032899-69032921 CCCACCGTGGACTGCTGGGGTTC No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415905_1084415921 11 Left 1084415905 11:69032878-69032900 CCCCAACTTTCCAGCCCCTGGCC No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415909_1084415921 1 Left 1084415909 11:69032888-69032910 CCAGCCCCTGGCCCACCGTGGAC No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415907_1084415921 9 Left 1084415907 11:69032880-69032902 CCAACTTTCCAGCCCCTGGCCCA No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415902_1084415921 24 Left 1084415902 11:69032865-69032887 CCCGGAGGAGTTTCCCCAACTTT No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415901_1084415921 27 Left 1084415901 11:69032862-69032884 CCTCCCGGAGGAGTTTCCCCAAC No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415903_1084415921 23 Left 1084415903 11:69032866-69032888 CCGGAGGAGTTTCCCCAACTTTC No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415911_1084415921 -4 Left 1084415911 11:69032893-69032915 CCCTGGCCCACCGTGGACTGCTG No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415912_1084415921 -5 Left 1084415912 11:69032894-69032916 CCTGGCCCACCGTGGACTGCTGG No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data
1084415906_1084415921 10 Left 1084415906 11:69032879-69032901 CCCAACTTTCCAGCCCCTGGCCC No data
Right 1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084415921 Original CRISPR GCTGGGGTTCCTGGTTGGTG CGG Intergenic
No off target data available for this crispr