ID: 1084422223

View in Genome Browser
Species Human (GRCh38)
Location 11:69066167-69066189
Sequence TGGGAACGTGGTGGTTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084422215_1084422223 14 Left 1084422215 11:69066130-69066152 CCTTGCTCCATGGGCGCTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1084422223 11:69066167-69066189 TGGGAACGTGGTGGTTTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 80
1084422218_1084422223 7 Left 1084422218 11:69066137-69066159 CCATGGGCGCTCGGTGGGTTGCT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1084422223 11:69066167-69066189 TGGGAACGTGGTGGTTTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 80
1084422209_1084422223 26 Left 1084422209 11:69066118-69066140 CCTGGCCCTAAACCTTGCTCCAT 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1084422223 11:69066167-69066189 TGGGAACGTGGTGGTTTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 80
1084422213_1084422223 20 Left 1084422213 11:69066124-69066146 CCTAAACCTTGCTCCATGGGCGC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1084422223 11:69066167-69066189 TGGGAACGTGGTGGTTTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 80
1084422212_1084422223 21 Left 1084422212 11:69066123-69066145 CCCTAAACCTTGCTCCATGGGCG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1084422223 11:69066167-69066189 TGGGAACGTGGTGGTTTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084422223 Original CRISPR TGGGAACGTGGTGGTTTGAC TGG Intronic