ID: 1084423614

View in Genome Browser
Species Human (GRCh38)
Location 11:69072561-69072583
Sequence CTCCCTTGGAACCCTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 247}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084423614_1084423621 0 Left 1084423614 11:69072561-69072583 CCCAGGCCAGGGTTCCAAGGGAG 0: 1
1: 0
2: 3
3: 54
4: 247
Right 1084423621 11:69072584-69072606 CCGAGCTGGCTGTGCTCACCGGG 0: 1
1: 0
2: 0
3: 13
4: 161
1084423614_1084423623 7 Left 1084423614 11:69072561-69072583 CCCAGGCCAGGGTTCCAAGGGAG 0: 1
1: 0
2: 3
3: 54
4: 247
Right 1084423623 11:69072591-69072613 GGCTGTGCTCACCGGGCTGTGGG 0: 1
1: 0
2: 1
3: 10
4: 200
1084423614_1084423625 26 Left 1084423614 11:69072561-69072583 CCCAGGCCAGGGTTCCAAGGGAG 0: 1
1: 0
2: 3
3: 54
4: 247
Right 1084423625 11:69072610-69072632 TGGGTTTTTCCCTGCAGAGTTGG 0: 1
1: 0
2: 3
3: 18
4: 223
1084423614_1084423622 6 Left 1084423614 11:69072561-69072583 CCCAGGCCAGGGTTCCAAGGGAG 0: 1
1: 0
2: 3
3: 54
4: 247
Right 1084423622 11:69072590-69072612 TGGCTGTGCTCACCGGGCTGTGG 0: 1
1: 0
2: 0
3: 22
4: 269
1084423614_1084423619 -1 Left 1084423614 11:69072561-69072583 CCCAGGCCAGGGTTCCAAGGGAG 0: 1
1: 0
2: 3
3: 54
4: 247
Right 1084423619 11:69072583-69072605 GCCGAGCTGGCTGTGCTCACCGG 0: 1
1: 0
2: 1
3: 14
4: 184
1084423614_1084423627 28 Left 1084423614 11:69072561-69072583 CCCAGGCCAGGGTTCCAAGGGAG 0: 1
1: 0
2: 3
3: 54
4: 247
Right 1084423627 11:69072612-69072634 GGTTTTTCCCTGCAGAGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 197
1084423614_1084423626 27 Left 1084423614 11:69072561-69072583 CCCAGGCCAGGGTTCCAAGGGAG 0: 1
1: 0
2: 3
3: 54
4: 247
Right 1084423626 11:69072611-69072633 GGGTTTTTCCCTGCAGAGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084423614 Original CRISPR CTCCCTTGGAACCCTGGCCT GGG (reversed) Intronic
900784941 1:4643178-4643200 ATCCCTTTGAAACCTGGACTTGG - Intergenic
900806867 1:4773287-4773309 CTCCCCTGGAACCCAGGGCAAGG + Intronic
900990082 1:6094594-6094616 CTCCCTTAGCACCCAGGCATCGG - Intronic
901187921 1:7387034-7387056 AGCCCCTGGAACCCTGCCCTTGG + Intronic
901422198 1:9158683-9158705 TCCTCTTGAAACCCTGGCCTGGG + Intergenic
902272927 1:15317517-15317539 CTCACTTGAAACCCTGCTCTTGG - Intronic
904936936 1:34137566-34137588 CTGCCTTTGAACTCTAGCCTGGG + Intronic
905274204 1:36806551-36806573 CTTCCTGGAAACCCTGGCCATGG + Intronic
905773895 1:40655513-40655535 CTCACCTTGAACCCTGGCTTGGG - Intronic
907248548 1:53123007-53123029 CCCTCTTGGCACCCAGGCCTGGG - Intronic
907282351 1:53359481-53359503 CTCTCTTGTAACTCTGTCCTGGG + Intergenic
907426710 1:54384300-54384322 CTCAGTTCGAGCCCTGGCCTTGG - Intronic
907635007 1:56125395-56125417 CTCCCTGGGGTCCTTGGCCTGGG - Intergenic
913379462 1:118192913-118192935 ATGCTTTGGAACACTGGCCTAGG + Intergenic
913959505 1:143327764-143327786 CTCCCCTGGAGCCCTGACCTGGG - Intergenic
913972401 1:143424517-143424539 CTCCCCTGGATCCCTGACCTGGG + Intergenic
914053864 1:144153337-144153359 CTCCCCTGGAGCCCTGACCTGGG - Intergenic
914066783 1:144250130-144250152 CTCCCCTGGATCCCTGACCTGGG + Intergenic
914112370 1:144716224-144716246 CTCCCCTGGATCCCTGACCTGGG - Intergenic
914125282 1:144813028-144813050 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
914843033 1:151264097-151264119 CTCCCCTGGAATCCTGAGCTAGG + Intronic
918428477 1:184434689-184434711 CTTCTTTGGAACCCTGTCATGGG - Intronic
919880673 1:201898683-201898705 CTCCCCTGGAAGTCTGGCCTGGG - Intronic
921005118 1:211085565-211085587 CTCCCCTTGACCCCTGGCCCAGG - Intronic
922724014 1:227914307-227914329 CACCCCTGGAGGCCTGGCCTGGG + Intergenic
922738868 1:228004814-228004836 CTCGCTTGAGAGCCTGGCCTGGG + Intergenic
923103615 1:230837323-230837345 CTCCCTTGGCCCCCTGGGTTTGG - Exonic
924261642 1:242237634-242237656 TGCCCTTGCAGCCCTGGCCTGGG + Intronic
924573372 1:245258089-245258111 CTCCCTAGGACCCCAGGCCTGGG - Intronic
1063467040 10:6253528-6253550 CCCCGCTGGCACCCTGGCCTGGG - Intergenic
1064012153 10:11743273-11743295 CTCCCTTTGCACCCTTGCCCCGG - Intronic
1069558804 10:69415335-69415357 ATGCCTTGGAACCCCGGCCCAGG + Intronic
1070617496 10:77980063-77980085 TTCCCTTGGAAGCCTAGCCATGG + Intronic
1072780447 10:98247611-98247633 CTCCCATGGAGCCAGGGCCTGGG - Intergenic
1073119571 10:101113354-101113376 CCCCCTTGGGAATCTGGCCTTGG - Intronic
1073205621 10:101767907-101767929 CTCCCATGGGTCCCTGGCCTGGG + Intergenic
1073324175 10:102632965-102632987 CTGCCTTGGAGCACTGCCCTTGG - Exonic
1074218181 10:111408749-111408771 CTCCCTTGGCACCCTAGGCAAGG + Intergenic
1075461634 10:122620426-122620448 CTCCCTGGGAACCTAGTCCTGGG + Intronic
1076570946 10:131432505-131432527 CTCCCTTGGCCACATGGCCTTGG - Intergenic
1076620161 10:131781945-131781967 TTCACTGGGAACCATGGCCTTGG + Intergenic
1076825961 10:132968369-132968391 CTGCCTTCAAACACTGGCCTCGG + Intergenic
1077307455 11:1874515-1874537 CTCCCCTGGAGCCCTGGCCTGGG - Intronic
1077332735 11:1990489-1990511 CTGCCTTGCAGCCCTGCCCTGGG + Intergenic
1077353638 11:2104768-2104790 CTCACTTGGGGCCCTGGGCTGGG - Intergenic
1077606437 11:3615964-3615986 AGCCCTTGGAACCCTGAGCTTGG + Intergenic
1078358299 11:10649068-10649090 CTTCCTTGGCTGCCTGGCCTCGG + Intronic
1084423614 11:69072561-69072583 CTCCCTTGGAACCCTGGCCTGGG - Intronic
1085791753 11:79502737-79502759 CTCACTTACCACCCTGGCCTGGG + Intergenic
1089052232 11:115555958-115555980 TTGCCTTGCAACCCTGGCTTGGG - Intergenic
1090522436 11:127493692-127493714 CTCCACTGGGTCCCTGGCCTTGG + Intergenic
1091094787 11:132810313-132810335 CTCCCAGGGAAACCTTGCCTAGG + Intronic
1202815718 11_KI270721v1_random:45665-45687 CTGCCTTGCAGCCCTGCCCTGGG + Intergenic
1091843480 12:3637031-3637053 CTCGTTTGGGACCCAGGCCTCGG - Intronic
1092539841 12:9414050-9414072 CTGGCTTTGAACCCTGGCTTTGG - Intergenic
1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG + Intergenic
1094443909 12:30508975-30508997 CTGCCTTTGAACACAGGCCTTGG + Intergenic
1096585247 12:52615703-52615725 CTTCCTTGGGACCCCTGCCTAGG - Intronic
1096599981 12:52722255-52722277 CTTCCTTGGAGTCCTTGCCTGGG - Intergenic
1098095306 12:66948122-66948144 CTTTCTTTAAACCCTGGCCTTGG - Intergenic
1098815824 12:75160485-75160507 CTGTGTTTGAACCCTGGCCTGGG - Intronic
1099049319 12:77763963-77763985 CTCTCCTGGATCCCAGGCCTCGG - Intergenic
1100713681 12:97283695-97283717 CCACCTTGCAGCCCTGGCCTGGG + Intergenic
1101997327 12:109534507-109534529 CTCCCTGGGCTCCCTGGCCTTGG + Intronic
1102295093 12:111730258-111730280 CTCCCTGGGAACACTGGACCAGG - Intronic
1102905417 12:116670951-116670973 CTCCCCTGGCACCCAGGCCCTGG + Intergenic
1103023640 12:117556365-117556387 CTCCCTTGAGACCCTGCCTTGGG - Intronic
1103325039 12:120114954-120114976 TTTCCTTGCAGCCCTGGCCTGGG - Intronic
1103872073 12:124099353-124099375 ATCCCATGGAACTCTGGGCTGGG + Intronic
1106590895 13:31097706-31097728 ATCCCTAGAAACCCTGGCATTGG + Intergenic
1108574281 13:51778122-51778144 CTCCCTCTGAACCCTGGCTCTGG + Intronic
1111669483 13:91311653-91311675 CTACCTTGTATCCTTGGCCTGGG - Intergenic
1114850971 14:26382094-26382116 CTCACTTGGAAGCCTGGGGTAGG - Intergenic
1116167087 14:41348512-41348534 CTCTCTTGGACCCCTGACTTGGG + Intergenic
1116320293 14:43454170-43454192 CTCCCTGGGATCCCTGGCAAAGG + Intergenic
1117337384 14:54766916-54766938 CTCCCTTGGTACCCTGGCTCTGG + Intronic
1119159184 14:72438961-72438983 CTGCCTTGGAGATCTGGCCTTGG + Intronic
1121443959 14:93967031-93967053 GTCCCTTGGTTCCCTGTCCTGGG - Intronic
1121837146 14:97102315-97102337 CTTCCATGGAATCCTGGTCTTGG - Intergenic
1122788823 14:104175971-104175993 CTCCCTGCGGGCCCTGGCCTCGG + Exonic
1123096875 14:105771006-105771028 CTGCCTTGGTGCCCTGGGCTGGG + Intergenic
1202929049 14_KI270725v1_random:22981-23003 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
1123423311 15:20148515-20148537 CTCCCCTGGAGCCCTGACCTGGG - Intergenic
1123532532 15:21155036-21155058 CTCCCCTGGAGCCCTGACCTGGG - Intergenic
1123973644 15:25532060-25532082 CTCCTTTGGAACGCATGCCTGGG + Intergenic
1124581076 15:30955606-30955628 ATCCATTGGAACACTTGCCTGGG + Intronic
1124722619 15:32123465-32123487 CTCTCATGGATCCCTGGCATGGG + Intronic
1126135090 15:45382275-45382297 ATCCCTGGGAACCTTGGCATAGG + Intronic
1127659848 15:61090160-61090182 CTGTCTAGGAACCCTGGTCTGGG + Intronic
1128234762 15:66059917-66059939 CTTCCCAGGAACCCTGGCCAAGG - Intronic
1128802114 15:70503600-70503622 GTCCCCTGGCTCCCTGGCCTGGG + Intergenic
1129169718 15:73800172-73800194 TTCCCCTGGGACCCAGGCCTTGG - Intergenic
1129844815 15:78763419-78763441 GTCCCTTCGATCCCTGTCCTTGG + Intronic
1129847101 15:78773000-78773022 CTCCCCTGGGCCCCTGTCCTTGG - Intronic
1130994362 15:88895632-88895654 CTCCCTTCGAGCCCAGCCCTTGG - Intergenic
1131880659 15:96858833-96858855 CTCTCTTGTCACCTTGGCCTGGG + Intergenic
1132179100 15:99738256-99738278 CTCCCTTGGAGCCCTAGCAAGGG + Intergenic
1132317493 15:100900618-100900640 CTGCCGTGCAACACTGGCCTTGG - Exonic
1132594788 16:743833-743855 CTCCCTGGGTTCCCTGGCCCTGG - Intronic
1132846647 16:2003880-2003902 GGCCCCTGGCACCCTGGCCTAGG + Intronic
1132988713 16:2781982-2782004 CTCTCTTGGAACCCTGTCTTGGG + Intergenic
1133973184 16:10581198-10581220 CTCACCTGGAGTCCTGGCCTTGG + Intergenic
1135191851 16:20360797-20360819 TTCCCTTGGAACCATGGCACTGG - Intronic
1136861507 16:33707087-33707109 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
1137379058 16:47981050-47981072 CTCCCTTGGAATCCTGGTTGAGG + Intergenic
1137871799 16:51956910-51956932 CTCCCTCTCAGCCCTGGCCTTGG + Intergenic
1138230310 16:55331497-55331519 CTCCCCAGGAATCCAGGCCTTGG - Intergenic
1138348175 16:56332555-56332577 CTCACTTGGAACACAGGCCCTGG + Intronic
1139458309 16:67102071-67102093 CTCTCTTGGATCACTTGCCTTGG - Intergenic
1139884234 16:70197342-70197364 CACCTTTGCAACCTTGGCCTTGG - Intergenic
1140368281 16:74398154-74398176 CACCTTTGCAACCTTGGCCTTGG + Intergenic
1141760480 16:86025793-86025815 CTCCCCTGCCAGCCTGGCCTGGG - Intergenic
1141921034 16:87135646-87135668 CTCCCTGTGAGCCCTGCCCTAGG + Intronic
1203123007 16_KI270728v1_random:1555278-1555300 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
1142572012 17:880912-880934 GCCCCTTGGAGCCCTGGCCCAGG - Intronic
1143350166 17:6282286-6282308 CTACCTCCGAACCCTGGCCTGGG + Intergenic
1144800057 17:17919980-17920002 CTTCCTGGTAAGCCTGGCCTTGG + Intronic
1145060280 17:19728831-19728853 CTTCCCTGGAACCCTGCCCCAGG - Intergenic
1145082728 17:19908527-19908549 TTCCCATGGATCCTTGGCCTAGG - Intronic
1146123149 17:30212296-30212318 CTCCCTTGGCACCCAGTTCTGGG - Intronic
1147426377 17:40347755-40347777 CTGCCTTGGGTCCCTGGCCCTGG + Intronic
1147911330 17:43857973-43857995 CTCCGTTGGAGTGCTGGCCTCGG - Intronic
1148760586 17:49997866-49997888 CTCCCGTGGACCCCTGGCTGAGG + Intergenic
1149515947 17:57280989-57281011 CCTCCTTGGGCCCCTGGCCTGGG - Intronic
1151821589 17:76499879-76499901 CCCCCTTGCAGCCCAGGCCTGGG - Intronic
1152784781 17:82242008-82242030 CTCCCTTGGCCCCTTGGCCAGGG - Intronic
1155031782 18:21991225-21991247 GTCCTTTGGAAACTTGGCCTGGG + Intergenic
1156087542 18:33424901-33424923 CTCCCCTCGAACCTTGGCATGGG + Intronic
1156337640 18:36185387-36185409 ATGCCTGGAAACCCTGGCCTAGG + Intergenic
1157783191 18:50458231-50458253 CTCACCTGGAACCCTGGTCTGGG + Intergenic
1157806114 18:50658772-50658794 CTCCCTAGGAGGCCAGGCCTGGG + Intronic
1159636952 18:70816642-70816664 CTCCCCTGGAAGCCTGGCAAGGG - Intergenic
1160468237 18:79101221-79101243 GTCCCTCTGAGCCCTGGCCTTGG + Intronic
1160823734 19:1069734-1069756 CTTCCTTGGAGGCCTGGCCTGGG + Intronic
1161231438 19:3176895-3176917 CTCCCTTGGACCCCAGGACAGGG + Intronic
1163846302 19:19640120-19640142 CAGCCTGGGAACCCTGGCCATGG - Exonic
1165655489 19:37528837-37528859 GTCCCTTGGAGCTCTGGCCTGGG + Intronic
1165810314 19:38607972-38607994 CTCCCTGGGGTCCCTGACCTGGG + Exonic
1166128905 19:40733634-40733656 CTCCCTGGGCATCCTGGCCCTGG + Intronic
1167550732 19:50159094-50159116 CTCCCTAGGTACCATGGCTTTGG + Intronic
1202693340 1_KI270712v1_random:105995-106017 CTCCCCTGGAGCCCTGACCTGGG - Intergenic
925905588 2:8537993-8538015 CTCCCTGGGAGCCCAGGCCCTGG - Intergenic
927502039 2:23589424-23589446 CACCCTTGGAGCTGTGGCCTTGG + Intronic
928437916 2:31267804-31267826 CTCCCTTGCCAGCCTGTCCTGGG - Exonic
929874350 2:45784213-45784235 CTTCCTTGGGATCCTGGCCAAGG - Intronic
932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG + Intergenic
933953228 2:87348564-87348586 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
934177094 2:89585455-89585477 CTCCCCTGGATCCCTGACCTGGG + Intergenic
934237459 2:90244909-90244931 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
934287401 2:91659814-91659836 CTCCCCTGGATCCCTGACCTGGG + Intergenic
934459886 2:94208215-94208237 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
934763544 2:96868862-96868884 CGCCCCAGGGACCCTGGCCTGGG + Intronic
936849809 2:116882038-116882060 TGCCCTTGGAACACTGGCTTGGG + Intergenic
937077305 2:119116687-119116709 TTCCCTTGGAATTGTGGCCTTGG - Intergenic
937378910 2:121357851-121357873 CTCCCTTGGCCACATGGCCTTGG + Intronic
938108804 2:128550924-128550946 CTCCTGCGGAACCCGGGCCTGGG + Intergenic
938237359 2:129717210-129717232 CTTCCTTGGGATCCTGGCTTGGG - Intergenic
938848761 2:135238746-135238768 CTCTCTTGGGACACTTGCCTTGG + Intronic
944191701 2:197010372-197010394 CTCCCTGGGAGCCCTTTCCTAGG + Intronic
945137561 2:206644555-206644577 CTCTCTAGGAACCATGGCTTAGG + Intergenic
947301066 2:228689141-228689163 CTCCCCAGAGACCCTGGCCTGGG + Intergenic
948017465 2:234702042-234702064 GGCCCTGGGAACGCTGGCCTGGG + Intergenic
948179854 2:235971065-235971087 CTCCCTTGGAACCTCTGCCTTGG - Intronic
948465805 2:238151067-238151089 CTCCCCGGGGACCCTGGCCCTGG - Exonic
949050770 2:241896276-241896298 CACCCATAGACCCCTGGCCTTGG + Intronic
949056855 2:241932496-241932518 CTTCCTGGAAACCTTGGCCTGGG + Intergenic
1169660841 20:7976554-7976576 CTGCCTGGGATGCCTGGCCTGGG + Intergenic
1169824551 20:9752937-9752959 CTCACTTGGAACCCTGTCACTGG + Intronic
1171838527 20:30180416-30180438 CTACGTAGGAACCCTGGCCATGG + Intergenic
1174085376 20:48004352-48004374 CTCTCCTGGAAGCCTGTCCTGGG - Intergenic
1175229087 20:57462015-57462037 CTCCCTTAGAACCCAGCCCTGGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176220662 20:63968014-63968036 CTGCCCTGGAGCCCTGCCCTTGG + Intronic
1176348920 21:5774466-5774488 CTCTCTAGGAACTCTGGCCCAGG - Intergenic
1176355734 21:5895050-5895072 CTCTCTAGGAACTCTGGCCCAGG - Intergenic
1176521743 21:7829701-7829723 GTCCCGGGGAACCCTGGGCTGGG - Intronic
1176543241 21:8172536-8172558 CTCTCTAGGAACTCTGGCCCAGG - Intergenic
1176562192 21:8355581-8355603 CTCTCTAGGAACTCTGGCCCAGG - Intergenic
1176591068 21:8651569-8651591 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
1177552647 21:22645800-22645822 CTCCCTAGGACCACTGGGCTTGG - Intergenic
1178655763 21:34459713-34459735 GTCCCGGGGAACCCTGGGCTGGG - Intergenic
1179151155 21:38809473-38809495 CTCCCTTTGATCCCTTCCCTGGG + Intronic
1179373809 21:40830928-40830950 CTCCATGGGATCCCTGGCCAAGG + Intronic
1180273896 22:10628602-10628624 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
1180285446 22:10741512-10741534 CTCCCTCGGAGCCCGGGCATGGG - Intergenic
1180850703 22:19018652-19018674 CTCCCTTCGTGCCCAGGCCTGGG - Intergenic
1181356320 22:22298284-22298306 CTCCCCTGGAGCCCTGACCTGGG - Intergenic
1182676277 22:32042294-32042316 CTCCCTCTGAACCCTGGCATGGG + Intergenic
1183380968 22:37490323-37490345 CTTGCTTGTATCCCTGGCCTGGG - Intergenic
1184048487 22:41987408-41987430 CTCCCCAGGGGCCCTGGCCTGGG - Intronic
1185239380 22:49734539-49734561 CTCCCCTGGAGCCCTGGCCGTGG - Intergenic
950568581 3:13786298-13786320 CTGCCTTGGGCCCCTGGCCTTGG + Intergenic
950936328 3:16843014-16843036 CTTCCTTGAACCCCTGGCTTCGG - Intronic
951282911 3:20774683-20774705 CTCCCCTAGAACCCTGGTTTTGG - Intergenic
952968535 3:38636477-38636499 CTCGCTCGGGGCCCTGGCCTGGG + Intronic
953534791 3:43769555-43769577 CTCCCTTGGCACCGTGCCCTGGG + Intergenic
953753438 3:45627103-45627125 GGCCCTTGGAACCCTGGGCATGG - Intronic
954131371 3:48562834-48562856 CTCCCTGGCAGCCCTGGCCCGGG + Exonic
954855954 3:53643585-53643607 CTCCCTGTGAAGCCTGTCCTTGG + Intronic
956455969 3:69420909-69420931 CTCCCTGAGAACACTGGACTTGG + Intronic
959111205 3:102124516-102124538 CTCCCTAGGAACCCTGGGGAGGG + Intronic
960256047 3:115512619-115512641 CTGCCTGGGAATCCTGGGCTGGG + Intergenic
962371499 3:134824384-134824406 CACCCTAGGAACCCAGACCTAGG - Intronic
962735790 3:138324052-138324074 CTCTCTTAGAGCCCTGTCCTAGG + Intronic
965668573 3:171122258-171122280 CTTCCTTTGAACCCTGCCCCCGG - Intronic
966703015 3:182877230-182877252 CTCCCTGGTACCCCTGGTCTAGG - Intronic
968596466 4:1488599-1488621 GTGCCTTGGAACCCAGGCCTGGG + Intergenic
976946126 4:90770061-90770083 CTCCCTTGGATCCCTTGTCCTGG + Intronic
981047602 4:140279812-140279834 CTACCCTGGAATACTGGCCTGGG - Intronic
982099717 4:151955979-151956001 CTCCCTTGGATCACTTGCTTGGG + Intergenic
984999867 4:185471876-185471898 CTTCCCTGGGAACCTGGCCTGGG + Intronic
985765673 5:1778202-1778224 CTCCCTGGGAACACTGGCAAAGG + Intergenic
986412391 5:7493824-7493846 ATCTCTAGCAACCCTGGCCTAGG + Intronic
988263776 5:28926402-28926424 CTCCCCTGGAGGCCTAGCCTGGG - Intergenic
988610992 5:32724845-32724867 CTCTCTTGGAACCCTAGCAGAGG - Intronic
988836448 5:35037268-35037290 CTCCTTTTGAACCCTGCTCTTGG - Intronic
992233312 5:74684566-74684588 CTCCTGTGGATCCCTGGCTTCGG - Intronic
993502067 5:88675841-88675863 GTCCCTTGGCACCCCGGCCTGGG + Intergenic
995216343 5:109599617-109599639 CTCCCAGGTAAACCTGGCCTAGG - Intergenic
997299108 5:132789408-132789430 CTCCCCTGGATCCCTGGCAGGGG - Intronic
998063705 5:139139299-139139321 CTCCCCTCGAACCCTGACCGTGG - Intronic
999089348 5:148921702-148921724 CTACCTTAGAAGCCTGGGCTAGG - Intergenic
999499920 5:152136719-152136741 CTCCCTGGGAAGCCTGATCTTGG + Intergenic
999636877 5:153632260-153632282 CTCCATTCTCACCCTGGCCTAGG - Intronic
1001509740 5:172311675-172311697 CTTCCTTGGACCACTGGGCTAGG + Intergenic
1001672722 5:173487530-173487552 ATCTCTTGGAAACCTGTCCTAGG - Intergenic
1002355563 5:178626544-178626566 TTCCCCTGGATTCCTGGCCTGGG - Intronic
1002465558 5:179406501-179406523 CTAGCTTGGAGCCCTGGTCTGGG + Intergenic
1003641852 6:7882227-7882249 CTCCCTGGATACCCAGGCCTGGG + Exonic
1004405490 6:15329251-15329273 ATCCCTTGGGACTCTGGCCTGGG + Intronic
1006392045 6:33764249-33764271 CTCCCTTGCAAGTCTGGCCTGGG - Intergenic
1006594226 6:35181305-35181327 CTCTCTTGCAACCCTGGTCATGG + Intergenic
1007064561 6:38976997-38977019 CTCCCTTGGAATCCTGGTTTGGG + Intronic
1012815757 6:104019589-104019611 ATCCCTTGGAGCCATGGCCTTGG - Intergenic
1014272680 6:119350287-119350309 CACCCGGGGAACCCCGGCCTTGG - Intergenic
1014591088 6:123271575-123271597 CTCCCTGGGAACCCAGGAATAGG + Intronic
1014828657 6:126075833-126075855 CTCCTTTGCAACCATGACCTTGG - Intergenic
1017774850 6:157672826-157672848 CTGCCCGGGAAGCCTGGCCTGGG + Exonic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1018899418 6:168043753-168043775 CCCTCATGGAGCCCTGGCCTTGG + Intronic
1019267980 7:129465-129487 GTCCCTTGCAACCCAGGCCAGGG - Intergenic
1019473918 7:1235180-1235202 CTCCGTTGGCGCCCTGGCCCAGG + Intronic
1019563012 7:1667254-1667276 CTCCCTGGGCAGCCTGGCCCCGG - Intergenic
1019575743 7:1736864-1736886 CTCCCTGAGAACCCTCTCCTGGG - Intronic
1020105465 7:5420503-5420525 CAGCCTTGGGACCCTGGCCTCGG - Intronic
1020665501 7:11036482-11036504 TTCCCTTGGAACCCAGGCCTGGG - Exonic
1020801015 7:12732615-12732637 CACTATTGGAACACTGGCCTGGG - Intergenic
1021171261 7:17400502-17400524 TTCCATTTGAACCCTGGCATAGG + Intergenic
1022863951 7:34398020-34398042 CTCTCTTGGATCACTTGCCTTGG - Intergenic
1023413565 7:39910965-39910987 CTCCCATGGAACCTCGGCATGGG + Intergenic
1023914906 7:44581757-44581779 CTGCCCTCGACCCCTGGCCTGGG - Exonic
1024634522 7:51276326-51276348 CTTCCTGGGAGCCCTGTCCTGGG + Intronic
1026958545 7:74393902-74393924 CAGCCCTGGAACCCTGGCCAGGG - Intronic
1026958696 7:74394817-74394839 CAGCCCTGGAACCCTGGCCAGGG - Intronic
1029248910 7:99222152-99222174 CTCCCTTTGGGCCCTCGCCTTGG - Intergenic
1029492786 7:100881543-100881565 GTCCCTTGAAACCCTTGTCTGGG + Intronic
1029609766 7:101620676-101620698 CTCCCTTGAACCCCCTGCCTTGG - Intronic
1032222601 7:130006016-130006038 TTGCCTTGCAACCTTGGCCTGGG - Intergenic
1033175387 7:139118943-139118965 CTCTCTTGGATCCCTTGCTTTGG + Intergenic
1034260744 7:149753775-149753797 TTCCCTGGGAACCCTCACCTGGG - Intergenic
1034526607 7:151667689-151667711 CTCTCTTGGAACCCTGTCACAGG + Intronic
1034931512 7:155167321-155167343 CTCCCTTGCAGCGCGGGCCTGGG - Intergenic
1035398442 7:158550000-158550022 CTCCCCTGGAACTCGGGGCTGGG + Intronic
1037959316 8:23084271-23084293 CTCACTTGGAGCCCTGGGCTGGG + Intergenic
1037966082 8:23135078-23135100 CTCACTTGGAACCCTGGGCTGGG - Intergenic
1038720258 8:30028581-30028603 CTCCCTGGGGTCCTTGGCCTGGG - Intergenic
1039834755 8:41247648-41247670 CTCCATTGGATCCCTGTCCTGGG - Intergenic
1042566628 8:70118088-70118110 CTCTGCTGGAGCCCTGGCCTAGG + Intronic
1043301920 8:78744488-78744510 CTCCCTGGGAACTCTGTCCCAGG + Intronic
1043512680 8:80965170-80965192 CTGGCTTGGAGCCCTGGCGTTGG + Intergenic
1045314021 8:101027756-101027778 CTCCCTTGGAAGCATGGTGTGGG + Intergenic
1047747054 8:127853125-127853147 CTCACTTGAAGCCCTGGCCTGGG - Intergenic
1048860980 8:138724391-138724413 CTCCCTGGGTGCCCTGGCCAGGG - Intronic
1049159417 8:141087689-141087711 CTCCCTTGGAAAGTTGCCCTGGG - Intergenic
1052915640 9:33922791-33922813 CTCCACTGGGCCCCTGGCCTCGG - Exonic
1053690388 9:40584023-40584045 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
1054301640 9:63384984-63385006 CTCCCCTGGAGCCCTGACCGGGG + Intergenic
1055093088 9:72382747-72382769 CTCCCCTGTGACCCTCGCCTTGG - Intergenic
1055514922 9:77024205-77024227 CTCCCTTGGGATCAGGGCCTTGG - Intergenic
1056953981 9:91067775-91067797 CTGCCCTGAAACCCTGGCCTGGG + Intergenic
1057302360 9:93894347-93894369 GTCCCTGGGTACCCTGGCCCTGG + Intergenic
1057863069 9:98657474-98657496 CCCCTGTGGAACCCTGGCCAGGG + Intronic
1061393406 9:130330255-130330277 CTGCCGTGGAGCCCTGTCCTTGG - Intronic
1061864961 9:133487439-133487461 CTCCCTGGGGACCCCGGCCCTGG - Intergenic
1061889173 9:133608793-133608815 TTCCCTCGGAACAGTGGCCTGGG - Intergenic
1062090796 9:134677859-134677881 CTCCCGTGGAACCATGCCATGGG - Intronic
1062385666 9:136310548-136310570 CTCCCGTGGCACCCTCCCCTAGG - Intergenic
1062448936 9:136607480-136607502 CCCCCTTGGGTCCCTGGCCTGGG - Intergenic
1203464512 Un_GL000220v1:72006-72028 CTCTCTAGGAACTCTGGCCCAGG - Intergenic
1203621085 Un_KI270749v1:130292-130314 CTCCCCTGGAGCCCTGACCTGGG + Intergenic
1187412305 X:19062077-19062099 CTCCATCTGACCCCTGGCCTAGG + Intronic
1190112252 X:47598976-47598998 CTACCATGGCACTCTGGCCTGGG + Intronic
1190119791 X:47650501-47650523 CCGCCTCGGAACCCAGGCCTGGG - Exonic
1190762626 X:53449332-53449354 CTCCCTTGGTTCCCTTCCCTAGG + Intergenic
1192185206 X:68941980-68942002 CTCCCTTGGCTCCCTGAACTTGG - Intergenic
1193265594 X:79464490-79464512 CTCCCGTGGAAGCCTGGCATGGG + Intergenic
1195401823 X:104468918-104468940 GTCCATTGGAACCCTCCCCTTGG - Intergenic
1196456396 X:115894368-115894390 CTCCCTTGGGAGACTGGCCTTGG + Intergenic
1197049908 X:122045724-122045746 CTCCCATGAAAGCCTGGCATGGG - Intergenic
1199720011 X:150536724-150536746 CACCCTGGGAAGCCTGGACTGGG - Intergenic
1200052559 X:153442744-153442766 TACCCTTAAAACCCTGGCCTTGG - Intergenic
1200150452 X:153948919-153948941 CTTTCCTGGCACCCTGGCCTGGG - Exonic
1200698443 Y:6381802-6381824 CTCACCTGGACCCCTGGCCATGG + Intergenic
1201035671 Y:9782897-9782919 CTCACCTGGACCCCTGGCCATGG - Intergenic
1202584546 Y:26409323-26409345 CTCCCCTGAAGCCCTGGCCTGGG - Intergenic