ID: 1084424710

View in Genome Browser
Species Human (GRCh38)
Location 11:69078347-69078369
Sequence CTGTGGCTGGATAGATAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084424703_1084424710 17 Left 1084424703 11:69078307-69078329 CCTTTGTGTATAAAGCGATTTCT 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1084424710 11:69078347-69078369 CTGTGGCTGGATAGATAGGACGG 0: 1
1: 0
2: 2
3: 23
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084424710 Original CRISPR CTGTGGCTGGATAGATAGGA CGG Intronic
900192299 1:1356613-1356635 CTGGGCCTGGCAAGATAGGAGGG + Intronic
900879455 1:5370204-5370226 CTGTGGCTGGAGAGAAATGAAGG - Intergenic
902359707 1:15935729-15935751 CTGTGGCTCGAGCGACAGGAAGG - Exonic
902404214 1:16174230-16174252 CTCTGGGTGGATGGAGAGGAGGG - Intergenic
902709880 1:18231351-18231373 CTCTGGCTGGATATTTGGGAAGG + Intronic
903234568 1:21941422-21941444 CTGTGGCTGGATTGATGGGCAGG - Intergenic
903935357 1:26891365-26891387 CTGTCAATGGATAGATAAGAGGG - Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904756203 1:32770150-32770172 CAGTGCCTGGATTGACAGGAGGG + Exonic
905340694 1:37275383-37275405 CTGTGGCTGCAGGGAGAGGATGG - Intergenic
905456346 1:38090661-38090683 TTGTGGCTGCAGAGATTGGATGG + Intergenic
905912954 1:41666291-41666313 CTCAGGCTGGAGAGAAAGGATGG - Intronic
907570279 1:55476850-55476872 GTGTTGCTGGAAAGATGGGAGGG + Intergenic
907763794 1:57388493-57388515 ATGCGGCTGGACAGAAAGGAGGG - Intronic
909711082 1:78649840-78649862 CTCTGTCTGGATAGCTAGGCAGG - Exonic
910216594 1:84850222-84850244 CGGTGGCTGGTTACATGGGAGGG - Intronic
916029366 1:160862786-160862808 CTGTGGCTGGACAGGTTGCAAGG - Intronic
916177870 1:162057660-162057682 CTGTGGCTCCCTTGATAGGAGGG - Intergenic
919944166 1:202307678-202307700 TTGTTGGTGGATAGAGAGGATGG - Intronic
921385420 1:214563894-214563916 CACTGGCTGGATAGATATTAAGG + Intergenic
923048862 1:230376146-230376168 CTGTGCCTGCATAGAAAGGAAGG - Intronic
924604549 1:245521575-245521597 CTGTGGCTGGGAAGACTGGAAGG + Intronic
1062990178 10:1807423-1807445 CTGTGCCTGGACAGGTAGGTGGG + Intergenic
1063007041 10:1982421-1982443 CTGTGGGTGGATACATGGGAAGG + Intergenic
1065159218 10:22901732-22901754 ATGTGGCTGGGAAGATAGCATGG - Intergenic
1065502121 10:26392504-26392526 CTGTGGATGAACAGACAGGAAGG - Intergenic
1068878803 10:62027159-62027181 ATGGGGCTTGACAGATAGGAAGG - Intronic
1068948011 10:62748758-62748780 CTTTGCCTGGATAAACAGGATGG - Intergenic
1071096030 10:81975910-81975932 CTGTGGCTGGCTTGGAAGGAAGG + Intronic
1074708959 10:116161145-116161167 GGGTGACTGGATAGACAGGAGGG + Intronic
1074925910 10:118070479-118070501 ATGTGGCTGGAGAGATAGGTGGG + Intergenic
1075668130 10:124245083-124245105 CTGTTGCTGGATGGGAAGGAGGG + Intergenic
1076230412 10:128815952-128815974 GGATGGATGGATAGATAGGAGGG + Intergenic
1076622378 10:131799848-131799870 CTGTGGCTTGATTGTGAGGAGGG + Intergenic
1076931793 10:133536647-133536669 GGGTGGATGGATGGATAGGAGGG + Intronic
1080826938 11:35856389-35856411 GTGTGTATGGGTAGATAGGATGG + Intergenic
1080826963 11:35856515-35856537 GTATGGGTAGATAGATAGGATGG + Intergenic
1082059310 11:47847070-47847092 CTGAGGCTGGAGAGGTAGGCAGG - Intronic
1082877548 11:58003344-58003366 CTGTGGCTGGAGAGATAGGGTGG - Intergenic
1083745066 11:64730906-64730928 CAGTGTCTGCACAGATAGGAGGG + Intronic
1083803442 11:65059624-65059646 GGGTGGATGGATAAATAGGAGGG - Intergenic
1084255608 11:67940472-67940494 CAGTGGATGGATACATAGGTGGG + Intergenic
1084424710 11:69078347-69078369 CTGTGGCTGGATAGATAGGACGG + Intronic
1084485348 11:69444843-69444865 ATGTGGCTGGAGAGAGTGGACGG + Intergenic
1085710861 11:78828001-78828023 CTGTGGCAGCACAGATAAGAGGG - Intronic
1086906359 11:92422544-92422566 CTGTGGCAGGGCACATAGGATGG + Intronic
1087528052 11:99343139-99343161 AGGTGGCTGGAAAGAGAGGAGGG + Intronic
1091063581 11:132488013-132488035 CTGTGGCTGCAAAGGTAGGCTGG - Intronic
1091934387 12:4423628-4423650 CTGTGGCTGGATTGAGAGATAGG + Intergenic
1092213362 12:6662927-6662949 CTGTGGCAGGAAATATTGGAGGG - Intronic
1092425843 12:8375206-8375228 CAGTGGATGGATACATAGGTGGG + Intergenic
1092619947 12:10253239-10253261 CAGTCTCTGGATACATAGGAGGG - Intergenic
1095249041 12:39957502-39957524 CTGAGGCTGGATAGAGTGGCAGG - Intronic
1096431602 12:51548830-51548852 TTGTGCATGGATAGATAGCAGGG - Intergenic
1098496740 12:71144278-71144300 CTGTCACCGGATAGATAGGAGGG - Intronic
1101085128 12:101227744-101227766 ATGTGGTAGGACAGATAGGATGG - Intergenic
1102776617 12:115525105-115525127 CTGTCCCTGGATTGAAAGGAAGG + Intergenic
1103593874 12:122011256-122011278 CTGTGGCTGGTGTCATAGGAAGG - Intergenic
1104988042 12:132608342-132608364 CAGTGGCAGGAAAGACAGGAGGG - Intronic
1106713354 13:32361730-32361752 CTGTGAGTGGATAGATATGAGGG + Intronic
1108840540 13:54608380-54608402 CTGTGATTGGGTAGATATGATGG - Intergenic
1110433585 13:75455106-75455128 GTGTAGTTGGAAAGATAGGATGG - Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113276068 13:108731989-108732011 CTGTGGATGGATACTTAGGCTGG - Intronic
1113376639 13:109770178-109770200 CTGTGGCTGGCAGGAAAGGAGGG + Intronic
1113835570 13:113326303-113326325 CTGAGGCTGGAGGGATAGGCTGG + Intronic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1116268691 14:42730628-42730650 CTCTGTCAGGAGAGATAGGAAGG + Intergenic
1116705433 14:48291530-48291552 TTGTGGTTGGATGGAAAGGAGGG + Intergenic
1117771917 14:59142030-59142052 CTGTGACTGAAAAGATAGGGTGG + Intergenic
1117780513 14:59226877-59226899 CTGTGGATGGCTACATAGGTTGG + Intronic
1118383081 14:65233663-65233685 CTGTGGATGGATATTTAGGTTGG + Intergenic
1118567559 14:67158491-67158513 CTGAGGCTGTAGAGATAGAAGGG + Intronic
1118592250 14:67410483-67410505 CTGTGGCTGAACTGATAGGCCGG - Intronic
1120745023 14:88144936-88144958 CTGAGGCTGGATAGGGAGGTTGG - Intergenic
1121735303 14:96214024-96214046 CTGGGGCTGGAGAGATGGGTAGG + Intronic
1122145424 14:99685757-99685779 CTGTGGCTGGTGACATAGGGAGG + Intronic
1122923579 14:104889980-104890002 GGGTGGATGGATGGATAGGAGGG + Intronic
1123633057 15:22275212-22275234 GGGTGGGTGGATAGATAGGGTGG - Intergenic
1123633064 15:22275233-22275255 GGGTGGGTGGATAGATAGGGTGG - Intergenic
1125321794 15:38496720-38496742 CTGTGTTTAGATAGATAGTAAGG + Intronic
1126426667 15:48534996-48535018 GTGTGGTGGGAGAGATAGGAGGG - Intronic
1127357617 15:58215694-58215716 CTGTAGGTAGATAGATAGGTAGG - Intronic
1127453603 15:59139151-59139173 GGGTGGGTGGATAGATGGGATGG - Intronic
1128578592 15:68792971-68792993 CTGAGGTTGGATAAAGAGGAGGG - Intronic
1131540078 15:93268424-93268446 CTGTGGCTGGATGTGGAGGATGG + Intergenic
1132766164 16:1535323-1535345 GTGAGGCTGCATAAATAGGAAGG + Intronic
1134112482 16:11524087-11524109 GCGTGGATGGATGGATAGGAGGG - Intergenic
1134112558 16:11524337-11524359 GGGTGGATGGATGGATAGGAGGG - Intergenic
1135761074 16:25138393-25138415 GGGTGGCTGGATAGCGAGGAGGG + Intronic
1135967615 16:27049007-27049029 GTGAGGCTGGAGAGGTAGGAGGG - Intergenic
1136034831 16:27531247-27531269 GTGTGGCTGGATAGGAAGGTAGG - Intronic
1137519069 16:49176363-49176385 CTATGGCTGCTTAGCTAGGAGGG + Intergenic
1137561700 16:49506539-49506561 AGGTGGGTGGATAGATAGGTGGG + Intronic
1139352807 16:66347916-66347938 CTGTTGCTGAATGGATAAGAAGG + Intergenic
1140061323 16:71572319-71572341 CTCTGGCTGGAGAGAAAGAAAGG + Exonic
1140220173 16:73038091-73038113 CTGTGACTGGAAAGAGGGGAAGG - Intronic
1141568578 16:84920435-84920457 CTGTGGCTGGGTTGCTGGGATGG - Intronic
1142096750 16:88244159-88244181 GTGTGGATGGACAGATAGGTGGG + Intergenic
1142152714 16:88519767-88519789 GGGTGGATGGATGGATAGGAGGG + Intronic
1142255314 16:89011148-89011170 CGGTGGATGGATAGATGGGTGGG - Intergenic
1142255350 16:89011300-89011322 CGGTGGATGGATAGATGGGTGGG - Intergenic
1142255368 16:89011372-89011394 CGGTGGATGGATAGATGGGTGGG - Intergenic
1142685030 17:1572645-1572667 CTGTGGCTGGCCAGATGGGTCGG - Intronic
1142687822 17:1587871-1587893 CTGTGGCTGGCCAGATGGGTCGG - Intronic
1143304308 17:5933773-5933795 CTGAGGCAGGATAGACATGAAGG - Intronic
1144793562 17:17875817-17875839 CTGTTGCTGCAAAGATGGGAGGG + Intronic
1144995172 17:19263073-19263095 CTGTCTCTGGATAGATAAGGAGG + Intronic
1147575505 17:41596571-41596593 CTGTGGCTGGAATGAGGGGATGG + Intergenic
1148877597 17:50699768-50699790 CTGTGGGTGTATAGATAAAAGGG + Exonic
1148952282 17:51323843-51323865 CTGTGGATGGATAAATGTGAAGG - Intergenic
1150681526 17:67288433-67288455 CTGGGGCTGGATGGAGATGATGG + Intergenic
1151370292 17:73643344-73643366 GTGTGGGTGGATGGGTAGGAGGG + Intronic
1151388310 17:73768998-73769020 CTGTGGCGGGAAGAATAGGAGGG + Intergenic
1152139563 17:78528557-78528579 CTGTGGCTGGACACAGAGAAGGG + Intronic
1152286925 17:79418048-79418070 CAGGGGCTGGGGAGATAGGAAGG + Intronic
1152321794 17:79611848-79611870 CTGTGCCTGGCTGGAGAGGAAGG + Intergenic
1153466110 18:5389525-5389547 CTGTGGCTGGAGAAGTAGGTGGG + Intergenic
1153659035 18:7310170-7310192 GTGTGGATGGATAGGTAGGTAGG + Intergenic
1154425664 18:14270228-14270250 CTGTGGCTGCATATAGAGGGGGG - Intergenic
1154484998 18:14866313-14866335 GTGTGGCTGGAGTGTTAGGAGGG + Intergenic
1158338913 18:56444516-56444538 ATGTGGCTGGAAAATTAGGAAGG - Intergenic
1159464971 18:68769786-68769808 CTGAGGCTGTAGAGATAGAATGG + Intronic
1160589399 18:79934629-79934651 CTGGGGCTGCGCAGATAGGAAGG - Intronic
1161899221 19:7105323-7105345 GGGTGGATGGATAGAAAGGAAGG + Intergenic
1163312547 19:16522822-16522844 CTGTGGTGGGAGGGATAGGAGGG + Intronic
1164823766 19:31269062-31269084 GTGTGGCTGGAGATAGAGGAAGG - Intergenic
1166112723 19:40632699-40632721 CTGTGGCTGGGCAGATAGTAAGG + Intergenic
1166219460 19:41355173-41355195 CTGTGTGGGGATAGATAAGACGG - Intronic
1166366845 19:42282126-42282148 CTGGGGCTGCATAGGAAGGAGGG + Intronic
1166641582 19:44498899-44498921 CTGTGGCTGTATCAGTAGGAGGG - Intronic
1167858466 19:52262652-52262674 CTGTGGCTGGAAATGTAAGATGG - Intergenic
1168268287 19:55235450-55235472 CTGTGGCTGAAAAAATAGGCAGG - Intronic
1168468611 19:56623227-56623249 CGGTGGGTGGAGGGATAGGAAGG - Exonic
925107619 2:1306504-1306526 CTGTGGCTGCATAGCTCGGGAGG - Intronic
925543516 2:4991942-4991964 ATGTTGCTGGAGAGATGGGATGG - Intergenic
925591065 2:5510575-5510597 CTGTGGCTGGGTAGATGTGTGGG - Intergenic
926287928 2:11505392-11505414 CAGTGGCTGGAGAGACAGGAAGG - Intergenic
927003996 2:18828468-18828490 CTGAGGCTTGATAGGAAGGAGGG - Intergenic
927029256 2:19103543-19103565 CTGTGGCTGGAGCAATAGCAGGG - Intergenic
927070523 2:19524188-19524210 CTGAGGCTGGAAAGGTAGGCAGG - Intergenic
927140906 2:20130179-20130201 ATGAGGCTGGACAGATAGGCAGG - Intergenic
928037539 2:27838989-27839011 CAGGGGCTGGACAGTTAGGAAGG + Intronic
929123716 2:38504081-38504103 CTGTTGCTGGCTTGATGGGAGGG + Intergenic
930116121 2:47719822-47719844 CTGAGGCAGGATAGGGAGGAGGG + Intronic
930228454 2:48818981-48819003 CTGTAGTTAGATAGATAAGAGGG + Intergenic
930678446 2:54230191-54230213 CTGTATCTGGAAAGAAAGGAAGG - Intronic
930960728 2:57258027-57258049 GAGGGCCTGGATAGATAGGATGG + Intergenic
931078525 2:58743222-58743244 GGGAGGCTGGATAGAGAGGATGG + Intergenic
934906892 2:98213095-98213117 CTGTGTCTGGAAAGACAAGAAGG + Intronic
935361909 2:102252299-102252321 CTGTGGCTGGACATTTAGGTTGG + Intergenic
936061538 2:109298283-109298305 CCGTGGCTGGCTAGACAGGCGGG + Intronic
936241550 2:110792274-110792296 CTGGGGTTGTATAGCTAGGAGGG + Intronic
937543394 2:122986945-122986967 CTGTGGCTTGAAAGATATGGGGG + Intergenic
939827365 2:147030894-147030916 CTGTGTCTTGATAAATAAGAAGG + Intergenic
940062510 2:149587888-149587910 ATTTGGGTGGATGGATAGGAGGG + Intergenic
946660487 2:221993840-221993862 ATGTGGCTGGAAAGGTAGGTAGG + Intergenic
947808554 2:232985017-232985039 CTGTGGCTGGAGAGATGGCTGGG - Intronic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
1172123850 20:32613730-32613752 ATTTGGCTGGATGGATAGGAGGG + Intergenic
1172132425 20:32664598-32664620 CTGTGGCTGCATCTAGAGGAGGG - Intergenic
1172230835 20:33334434-33334456 TGGTGGATGGATGGATAGGAAGG + Intergenic
1174521992 20:51138817-51138839 CTGTGGCTAGAGAGATGGGCAGG - Intergenic
1174541033 20:51289795-51289817 GTGTGCCTGGAAAGAAAGGATGG - Intergenic
1175742453 20:61429625-61429647 GTGTGGGTGGATAGATGGGTGGG + Intronic
1175745800 20:61456121-61456143 GAGTGGATGGATAGATAGGTAGG + Intronic
1176723673 21:10413094-10413116 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1176796330 21:13373162-13373184 GTGTGGCTGGAGTGTTAGGAGGG - Intergenic
1176796418 21:13373733-13373755 GTGTGGCTGGAGCGGTAGGAAGG + Intergenic
1179101359 21:38357865-38357887 GTGAGGCTGGAGAGAGAGGAAGG - Intergenic
1179774384 21:43651410-43651432 CTGTGGCTGTATGGATGGAATGG - Intronic
1180304829 22:11065871-11065893 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1180959466 22:19756082-19756104 CTGTGCCTTTATGGATAGGAGGG + Intergenic
1181163537 22:20971517-20971539 CCTTGTCTGGGTAGATAGGAAGG + Intronic
1182660638 22:31922657-31922679 ATGTTGCTGGATAGGTAGGTGGG - Intergenic
1182691227 22:32164839-32164861 CTGTGTCTGGATGGAGGGGAGGG + Intergenic
1184880722 22:47302779-47302801 GGATGGATGGATAGATAGGATGG - Intergenic
1184967684 22:47993012-47993034 ATGTTGCTTGATAGATAGCAAGG - Intergenic
1185063761 22:48620705-48620727 GTGTGGGTGGGTGGATAGGATGG - Intronic
949125043 3:437089-437111 CTGTGGCTGGGAAGACAGTATGG - Intergenic
950025809 3:9819248-9819270 CTGTGGAAGGATAGGTAGGCAGG - Intronic
950650893 3:14406015-14406037 CTGTGGGTGGAGAAACAGGATGG + Intronic
950750928 3:15127293-15127315 CAGTGGATGGATACATAGGTGGG - Intergenic
951643602 3:24863274-24863296 CTGTGGCTGGTTAGCTCGGTTGG - Intergenic
953098022 3:39798073-39798095 CTCTGGCTGGATATATTAGAAGG - Intergenic
953221328 3:40974247-40974269 CTGAGACTGGATGGATAAGAAGG - Intergenic
955920127 3:63946724-63946746 CTGAGGCTGGAGAGATGGGAGGG + Intronic
956538335 3:70304922-70304944 GAGTAGCTGGATAGAAAGGAAGG - Intergenic
958448897 3:94249055-94249077 CTGTGGCTGGATAGAAACGAGGG + Intergenic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
961726426 3:128933879-128933901 AGGAGGCTGGAGAGATAGGAAGG - Intronic
961787504 3:129356617-129356639 ATGGGGCTGGGTAAATAGGAAGG + Intergenic
965537353 3:169836996-169837018 GTGTTGCTGGGTAGGTAGGAGGG + Intronic
968742866 4:2340141-2340163 CTGTGGCTCCCTAGATAGGCTGG - Intronic
969308931 4:6340875-6340897 CTGTGGCTGGATACAGAGGCTGG - Intronic
970197729 4:13569091-13569113 CTGAAACTGGATAGACAGGAGGG + Exonic
970627343 4:17902161-17902183 ATGTGGCTGGATAGGTGGGCAGG + Intronic
971296788 4:25400850-25400872 GAGAGGCTGGACAGATAGGAGGG + Intronic
975079529 4:70259588-70259610 TTATGGCTGCATAGATAGGTGGG + Intergenic
975528471 4:75376530-75376552 ATGTGGCTGAAAAGATAGGCTGG - Intergenic
977689475 4:99889667-99889689 ATGTGGCTGGAGAGGAAGGATGG + Intronic
979672975 4:123380941-123380963 GTGTGGCTGGAGAGAGAGGCAGG + Intergenic
980279104 4:130694855-130694877 CTGTGGCTGTATAGATTTTAAGG - Intergenic
983224617 4:165074255-165074277 GTGAGACTGGATAGAGAGGAAGG + Intergenic
985790473 5:1924248-1924270 CTTTGGCTCGAAAGAAAGGATGG + Intergenic
987371520 5:17197869-17197891 CTTTGGATGGATAGATTGGTTGG + Intronic
988342835 5:29997214-29997236 ATATGGATGGATAGAAAGGAAGG + Intergenic
991209088 5:64084143-64084165 CTCTGCCTGGAGAAATAGGAAGG - Intergenic
996404023 5:123089551-123089573 CTAGGGCTTGGTAGATAGGAAGG + Intronic
997311412 5:132886809-132886831 GTGTGACTGGAGAGATAGGCAGG - Intronic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
998783549 5:145684722-145684744 CTGTGGCTGTATATTCAGGAAGG + Intronic
1001173198 5:169441259-169441281 CAGTGGCCTGAGAGATAGGAGGG + Intergenic
1001206447 5:169768066-169768088 CTGTAGCAGGAAAGATAAGAAGG + Intronic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001980947 5:176036776-176036798 GTGTGGCTGGAGCGGTAGGAAGG + Intergenic
1002236512 5:177807289-177807311 GTGTGGCTGGAGCGGTAGGAAGG - Intergenic
1002989729 6:2227652-2227674 TTGTGGCTGGAACTATAGGAAGG + Intronic
1003195120 6:3907510-3907532 CTGGGTCTGGAAAGAAAGGAAGG - Intergenic
1003731191 6:8826497-8826519 CAGTGGCTGGACAGATTGCAAGG - Intergenic
1004164962 6:13249004-13249026 CTGTGGCTGGCAAGGGAGGACGG - Intronic
1004449413 6:15730972-15730994 CTGTGTCTGGAAAGGCAGGAGGG - Intergenic
1004928464 6:20438664-20438686 CTTTGGCTGCACAGATTGGAAGG + Intronic
1006115818 6:31775740-31775762 CTGTGGCTGGAGAGAAGTGAGGG - Intronic
1006645950 6:35514170-35514192 CTGTGGCTGGATGAAGAGTATGG - Intergenic
1007693966 6:43719931-43719953 ATGTGGCTGGATAAAAAGCAAGG - Intergenic
1008044275 6:46835557-46835579 CTGTGGCTGGGGAGACAGGCAGG + Intronic
1011317197 6:86048670-86048692 CAGAGGGTGGAAAGATAGGAGGG - Intergenic
1014095687 6:117458051-117458073 CTGTAGCTGGAAAGAGAGCAGGG - Intronic
1015543919 6:134343239-134343261 CTGTGGTTGGGTGAATAGGAAGG + Intergenic
1016014458 6:139169620-139169642 CTGTGGGTGGATTGTTAGGTTGG + Intronic
1017345331 6:153372802-153372824 GTTTGACTGGATAAATAGGAAGG + Intergenic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1018515499 6:164575360-164575382 CTAGGGCTGGATACATAGGAGGG - Intergenic
1020081328 7:5287483-5287505 CTCTGGATGGATAGAAAGGACGG + Intronic
1021401495 7:20214309-20214331 GTGTAGCTGGAAAGAAAGGAGGG - Intronic
1022681917 7:32556734-32556756 CTGTGGCTGGATAGTGATGATGG - Intronic
1024127721 7:46317730-46317752 CTGTGGCTGGAAACGTAGGATGG + Intergenic
1025197587 7:56944701-56944723 CTATGGATGGACAGAAAGGATGG - Intergenic
1025259113 7:57405258-57405280 CTCTGGCTGGAGAGAAAAGAGGG - Intergenic
1025609739 7:63067896-63067918 CTCTGGCTGGAGAGAAAAGAGGG + Intergenic
1025674360 7:63632238-63632260 CTATGGATGGACAGAAAGGACGG + Intergenic
1025710236 7:63901301-63901323 CTCTGGCTGGAGAGAAAAGAGGG - Intergenic
1027221912 7:76219598-76219620 CTGTCTTTGAATAGATAGGAAGG - Intronic
1028409847 7:90517970-90517992 CTGTTGCTGGGTGGATAGAAGGG - Intronic
1029630698 7:101748303-101748325 CGGAGGCTGGAGAGAAAGGATGG + Intergenic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1033061136 7:138109362-138109384 ATGTGGGTGGAGAGAAAGGAGGG - Intronic
1033795251 7:144837923-144837945 GTGTGGCTGGAGAAATAGCAGGG - Intergenic
1034270114 7:149799671-149799693 CAGGGGCTGGAGAGAAAGGAGGG - Intergenic
1035057136 7:156043267-156043289 CTGTGGCTGGGAAGTTTGGAAGG - Intergenic
1035769476 8:2135537-2135559 CTGTGACGGGGTAGGTAGGAAGG - Intronic
1036388401 8:8302958-8302980 CTGGGGATGGATAGGTAGCAAGG + Intergenic
1036896946 8:12643961-12643983 CAGTGGATGGATACATAGGTGGG + Intergenic
1036897018 8:12644265-12644287 GGGTGGGTGGATAGATAGGTAGG + Intergenic
1037559291 8:20058087-20058109 ATGTGGATGGAGAGATGGGAAGG - Intergenic
1038004311 8:23417007-23417029 CTGTGGCTGGAAGGCTGGGAAGG - Intronic
1038133086 8:24755794-24755816 CTGAGGCTGGCTACATAGAATGG - Intergenic
1038248160 8:25878347-25878369 GGGTGGCTGGAAAGACAGGAGGG + Intronic
1038494425 8:27991389-27991411 CTGAGACTGGCTAGGTAGGAGGG - Intronic
1038966539 8:32579405-32579427 CTGAGGCTGGAGAGAAAGAAGGG + Intronic
1040913178 8:52541929-52541951 ATGTGGCTGGAAAGGTAGGTTGG - Intronic
1042325669 8:67525190-67525212 CTGTGGTTGGAAAGAAAGGATGG - Intronic
1042499456 8:69492509-69492531 CTGTGGCAGGATGGAGTGGATGG - Intronic
1046013430 8:108577352-108577374 GTCTGGCTGGGGAGATAGGATGG - Intergenic
1046105051 8:109655024-109655046 TTGAGGCTAGAGAGATAGGATGG - Intronic
1047457445 8:125028948-125028970 ATGAGTCTGGATAGATAGCAGGG - Intronic
1048893127 8:138965515-138965537 CTGTGACTGGATTGGAAGGATGG + Intergenic
1049246151 8:141563665-141563687 TGGTGGATGGATAGATTGGATGG - Intergenic
1050856629 9:10365326-10365348 CTGTGGCTGGAAACATAGTCAGG - Intronic
1053459126 9:38254967-38254989 CTGCGGCTGGAAAGATGGCAGGG - Intergenic
1053653327 9:40191434-40191456 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1053903729 9:42820724-42820746 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1058703014 9:107616267-107616289 ATGTGGATGGATGGATAGGTGGG - Intergenic
1059419841 9:114184037-114184059 GAATGGCTGGAGAGATAGGAGGG + Intronic
1061846946 9:133393298-133393320 CAGTGGATGGATAGATGGGTGGG + Intronic
1061965247 9:134010178-134010200 GTCTGGCTGGATGGTTAGGATGG + Intergenic
1062144673 9:134982453-134982475 CTGTGGCTGGAGAGTCAGGCTGG + Intergenic
1185498015 X:572551-572573 CTGTGGCTGGACAGACATCAAGG + Intergenic
1185808578 X:3083092-3083114 CTATGGGTGGATAGATAGATAGG - Intronic
1185892931 X:3836295-3836317 CTGGGGCTGGATGGATGGGACGG - Intronic
1185898040 X:3874715-3874737 CTGGGGCTGGATGGATGGGACGG - Intergenic
1185903159 X:3913146-3913168 CTGGGGCTGGATGGATGGGACGG - Intergenic
1186566336 X:10666843-10666865 CTATGGATGGATAGAAAGGCAGG + Intronic
1187543146 X:20219048-20219070 ATGTAGCTGGATAGGTAGGGAGG + Intronic
1189704628 X:43747697-43747719 CTTTGGCTTTATAGATAGAATGG + Intergenic
1189885540 X:45540772-45540794 ATGTGGGTGGATACATAGGAGGG + Intergenic
1190477239 X:50840198-50840220 CTGTGCCTGCAGAGAGAGGAAGG - Intergenic
1190512034 X:51182842-51182864 ATGTGGGTGGGTAGATAGGGTGG - Intergenic
1191910673 X:66146171-66146193 TTGTAGATAGATAGATAGGAAGG + Intergenic
1194809596 X:98374515-98374537 CAGTGGCTAGAGAGATAGGCAGG - Intergenic
1195296751 X:103486091-103486113 CTGTGGCTGAATAGGAATGAAGG + Intergenic
1196143900 X:112296150-112296172 ATGAGGTTGGATAGAGAGGAAGG - Intergenic
1197451910 X:126629436-126629458 CTGGGGCTGCATAGAGAAGAGGG + Intergenic
1197555740 X:127950505-127950527 CTGTGTTTGGATAGATAAAAAGG + Intergenic
1199427306 X:147717777-147717799 ATGTGACTGGACAGATAGAAGGG - Intergenic
1199976765 X:152898823-152898845 CTGTGGCTGGATTGTTTTGATGG + Intergenic
1200137665 X:153882927-153882949 CTGTGGCTGGAAAAAGAGGGAGG - Intronic
1201305887 Y:12550272-12550294 AAGTGGGTGGATAGATAAGAGGG + Intergenic