ID: 1084426254

View in Genome Browser
Species Human (GRCh38)
Location 11:69085957-69085979
Sequence TGATTCTCCGTGCAGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084426248_1084426254 -3 Left 1084426248 11:69085937-69085959 CCTCGTCTCCCTGACGGCAGTGA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1084426254 11:69085957-69085979 TGATTCTCCGTGCAGCCTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1084426245_1084426254 6 Left 1084426245 11:69085928-69085950 CCCGTGAGTCCTCGTCTCCCTGA 0: 1
1: 0
2: 3
3: 15
4: 136
Right 1084426254 11:69085957-69085979 TGATTCTCCGTGCAGCCTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1084426246_1084426254 5 Left 1084426246 11:69085929-69085951 CCGTGAGTCCTCGTCTCCCTGAC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1084426254 11:69085957-69085979 TGATTCTCCGTGCAGCCTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084426254 Original CRISPR TGATTCTCCGTGCAGCCTGG GGG Intronic