ID: 1084426254

View in Genome Browser
Species Human (GRCh38)
Location 11:69085957-69085979
Sequence TGATTCTCCGTGCAGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084426246_1084426254 5 Left 1084426246 11:69085929-69085951 CCGTGAGTCCTCGTCTCCCTGAC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1084426254 11:69085957-69085979 TGATTCTCCGTGCAGCCTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1084426245_1084426254 6 Left 1084426245 11:69085928-69085950 CCCGTGAGTCCTCGTCTCCCTGA 0: 1
1: 0
2: 3
3: 15
4: 136
Right 1084426254 11:69085957-69085979 TGATTCTCCGTGCAGCCTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1084426248_1084426254 -3 Left 1084426248 11:69085937-69085959 CCTCGTCTCCCTGACGGCAGTGA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1084426254 11:69085957-69085979 TGATTCTCCGTGCAGCCTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084426254 Original CRISPR TGATTCTCCGTGCAGCCTGG GGG Intronic
900121463 1:1050218-1050240 TGACTCTCCCTACAGCCTCGGGG + Exonic
900294326 1:1941292-1941314 TGATGCTCAGTGGAGCTTGGTGG - Intronic
900501261 1:3005841-3005863 TGATTCTCAGGAGAGCCTGGAGG - Intergenic
902254772 1:15180993-15181015 GGATTCTCCGTCCAGTCTGCAGG - Intronic
907485780 1:54777232-54777254 TGATCCTCCCAGCAGCCTAGTGG + Intergenic
911579640 1:99619878-99619900 TGATTCTCAGAACTGCCTGGTGG - Intergenic
912073292 1:105840379-105840401 TCATTCTCCTTGCTGCCTTGTGG + Intergenic
921901004 1:220450796-220450818 TGTTTCGCTGTGCAGCCTTGTGG + Intergenic
923769301 1:236923973-236923995 TGATTCTCTGTTCAGCCTGATGG + Intergenic
924808859 1:247383706-247383728 TGGTTCCCCATGCAGCCTGTTGG - Intergenic
1063172547 10:3522553-3522575 TGAATCTCCGTGCAGACGGTAGG - Intergenic
1063616925 10:7608229-7608251 AGATTCACCGAGCAGCCTGGAGG - Intronic
1066354410 10:34667862-34667884 TTCTCCTCCGTGCAGCCTGAAGG + Intronic
1067010731 10:42711146-42711168 TGATTCTTCTTGCAACCAGGGGG - Intergenic
1069894750 10:71673425-71673447 TGATTGTCAGTGGAACCTGGGGG + Intronic
1074060693 10:109962828-109962850 TGCTTCTCCCTGGGGCCTGGTGG + Intergenic
1077284709 11:1760467-1760489 TGCTGCTCCGTGAAGCCAGGCGG - Intronic
1080860995 11:36150068-36150090 CGATACCCCCTGCAGCCTGGTGG - Intronic
1081668357 11:44929599-44929621 TGAATCTCCGTGCAGCCCCTGGG - Exonic
1082725892 11:56736324-56736346 TGTTGCTCCTTGCAGCCTGCAGG + Intergenic
1084426254 11:69085957-69085979 TGATTCTCCGTGCAGCCTGGGGG + Intronic
1086720560 11:90116217-90116239 TCATTCTCCGTCCAGGCTGGAGG + Intergenic
1090411222 11:126511360-126511382 TGCCTCTCCAGGCAGCCTGGGGG - Intronic
1091232000 11:133994161-133994183 TGCATGTCCCTGCAGCCTGGAGG - Intergenic
1091407487 12:218428-218450 TGAGGCCCCGCGCAGCCTGGTGG + Intergenic
1100067797 12:90671242-90671264 TGATTATTCTTGTAGCCTGGAGG - Intergenic
1102644892 12:114397381-114397403 TGATTCTCACGGCAGCCTAGGGG - Intronic
1105745997 13:23377396-23377418 GGTTTTTCCGTGGAGCCTGGTGG + Intronic
1107664360 13:42673752-42673774 TGCTTCTCCCTGCTCCCTGGGGG - Intergenic
1107993709 13:45840616-45840638 TGCTTCTCTATGCTGCCTGGTGG - Intronic
1108930142 13:55807526-55807548 TGCTGCTCCGTGCGGCCTTGGGG - Intergenic
1110292217 13:73820258-73820280 TGATTCTGTGTGCAGCCAGCAGG - Intronic
1116494506 14:45544810-45544832 TGATGCTTAGTGCAGCCTTGGGG + Intergenic
1118044025 14:61947168-61947190 GGATTCTCCGTGCATTCTGACGG - Intergenic
1119903629 14:78282383-78282405 TGCTTCTCCCTCCTGCCTGGAGG + Intronic
1121468039 14:94128532-94128554 TGTTTCTGCGGGGAGCCTGGTGG - Exonic
1121615536 14:95311331-95311353 GGGTTCTCCATGCAGCCAGGAGG - Intronic
1122864440 14:104597186-104597208 TGTTTCTGGCTGCAGCCTGGGGG - Intronic
1126731628 15:51689321-51689343 TGATTCTCAGTCCAGCTTGTGGG - Exonic
1127853347 15:62934515-62934537 TGCTTCTATGTGCAGCCTTGAGG - Intergenic
1128151610 15:65366723-65366745 TGCATCTCCCTGCAGTCTGGGGG + Intronic
1130998875 15:88922075-88922097 CCATTCCCCGTGCAGCCTGTTGG + Intergenic
1132321852 15:100931140-100931162 TGCTTCTTTGTGCAGCATGGGGG - Intronic
1136038900 16:27562349-27562371 TGATTCTCCTAGCAGCCTTATGG - Intronic
1140264281 16:73407179-73407201 TCATTCTCCGTGGTGGCTGGAGG - Intergenic
1145937249 17:28721847-28721869 TGATTCTAGGTCCAGCTTGGTGG - Intronic
1146983426 17:37188396-37188418 TGATTTTCAGTTCTGCCTGGAGG + Exonic
1154197637 18:12278297-12278319 AGATTCTGCCTGCAGCCAGGTGG + Intergenic
1160976325 19:1794503-1794525 GGATTCTGCGTCCAGCCTGGGGG - Intronic
1162930018 19:13952926-13952948 TGATTCTCCCTGCGGCCTCTGGG - Intronic
1163677110 19:18660663-18660685 CGCTTCTCCGTCCAGGCTGGGGG + Intronic
1165961979 19:39542409-39542431 TGACTCTCCAGGCAGCCTGAGGG - Intergenic
1167678024 19:50900660-50900682 TGGTTCTACAAGCAGCCTGGAGG - Intergenic
1168307395 19:55442889-55442911 TCGTTCTCCCCGCAGCCTGGCGG - Intergenic
1168313292 19:55472493-55472515 AGACTCCTCGTGCAGCCTGGGGG - Intergenic
925785775 2:7430613-7430635 TGATTCTACGTGGAGCCCTGAGG + Intergenic
926135101 2:10330904-10330926 AGCTTCTGGGTGCAGCCTGGGGG + Intronic
927410294 2:22817354-22817376 TGATTGTCCCTGGAGCCTTGAGG - Intergenic
928894292 2:36243250-36243272 TAATTATCTGTGAAGCCTGGAGG + Intergenic
932336491 2:70934613-70934635 TGTTTCTCAGAGCAGACTGGAGG - Intergenic
932466832 2:71929460-71929482 TGCTTGTCTGTGCAGCCTGCAGG + Intergenic
933664856 2:84956667-84956689 TGATTCTCACTGCAACCTTGAGG + Intergenic
934490443 2:94758962-94758984 TAATTCTCCAAGCAGCCTCGTGG + Intergenic
937886034 2:126900534-126900556 TGATTCTCCGTGCTAAGTGGAGG - Intronic
938492259 2:131767590-131767612 TGACTCTCCCTTCAGCCTTGTGG + Intergenic
938495309 2:131794760-131794782 TGACTCTCCCTTCAGCCTTGTGG - Intergenic
943040036 2:182793455-182793477 TGGTTCTCAGTGCTGCCTGATGG - Exonic
946420217 2:219560682-219560704 GGAGTCTCCGTGGAGGCTGGGGG - Intronic
1169196739 20:3687211-3687233 TGACTCCCCCTGCAGCCTGGTGG - Exonic
1169760858 20:9092377-9092399 TGATTCTCTCTGAAGCCTGTTGG + Intronic
1172205512 20:33160273-33160295 TGACTCTCCCCGCAGCCTGCAGG - Intergenic
1172758707 20:37306862-37306884 TGGTTCTATGTGCAGCCTTGTGG - Intronic
1174832653 20:53827186-53827208 TGATGCCCTGTGCAGCCTTGCGG - Intergenic
1175430506 20:58898956-58898978 TGTTGCTCCTTGCAGCCTGCGGG - Exonic
1179908641 21:44436662-44436684 GGATGCTGAGTGCAGCCTGGGGG - Intronic
1181537810 22:23555812-23555834 TGAGTCTCCCTTCAGACTGGGGG - Intergenic
1183341044 22:37281893-37281915 TGAGTTTCCCAGCAGCCTGGGGG + Intergenic
1184093982 22:42306575-42306597 TAATTCTCCCACCAGCCTGGAGG - Intronic
1184918170 22:47587515-47587537 TCATTCTGTGAGCAGCCTGGAGG - Intergenic
949998818 3:9640780-9640802 TGGTTTCCCGTGCAGCCTGTTGG - Intergenic
950764677 3:15265036-15265058 TGCTTCTGCTTGCAGCCTAGAGG - Intronic
953666474 3:44929570-44929592 TGATTCTCACCGTAGCCTGGAGG - Intronic
954293146 3:49660342-49660364 TGATTTACCAGGCAGCCTGGAGG - Intronic
959471506 3:106757440-106757462 TGATTGGAGGTGCAGCCTGGTGG - Intergenic
960610833 3:119553535-119553557 ACCCTCTCCGTGCAGCCTGGAGG + Intronic
960978046 3:123195635-123195657 TGACTCTCCCTGCAGCTGGGTGG - Intronic
965977388 3:174641528-174641550 TCTTTCTCCTTGCAGCCTTGAGG - Intronic
967817656 3:193812937-193812959 TGTTTCTTCCTGCAGCCTTGGGG + Intergenic
968872320 4:3248240-3248262 TGGTCCTCCGGCCAGCCTGGGGG + Exonic
969548285 4:7846498-7846520 TGATTCTCATAGCGGCCTGGAGG + Intronic
970223500 4:13834214-13834236 TGAATATCAGTGCTGCCTGGAGG - Intergenic
971275883 4:25196090-25196112 TGTCTCTCCATGCATCCTGGTGG - Intronic
972084492 4:35198131-35198153 TGAGTCTCCATGGAGCCTGTAGG + Intergenic
976484728 4:85588390-85588412 TCATTCTCTGCCCAGCCTGGAGG + Intronic
985946134 5:3185588-3185610 TCCTTCTCCGTGCAGCTTGGGGG + Intergenic
986263934 5:6176472-6176494 TGCTTCTCCGTGCAGCCTCTGGG - Intergenic
988629815 5:32916845-32916867 TCATTCTCCCTGCATCCAGGTGG - Intergenic
990651140 5:57900815-57900837 TGATTCTCTGTGAAACCTGCAGG - Intergenic
995782449 5:115792820-115792842 TCCTTCTCCTTGGAGCCTGGTGG + Intergenic
997531132 5:134581854-134581876 TCCTTCTCCTTGCAGCCTGCTGG - Exonic
1003297798 6:4848804-4848826 GGCTTCTCTGTGAAGCCTGGTGG + Intronic
1003867682 6:10378331-10378353 TGAGTCTCCCTGCATCCTGTGGG - Intergenic
1006236888 6:32641470-32641492 TGTTTCTCAGTGCACCCTGCGGG - Exonic
1012597377 6:101055618-101055640 GGATGCTCTGTGCAGCCTTGGGG - Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1019525219 7:1477666-1477688 ACCTTCTCCCTGCAGCCTGGAGG - Exonic
1021828627 7:24580014-24580036 TGATTCTCTGAGCAGACTGGGGG + Intronic
1023008912 7:35907734-35907756 TGCTTCTCCAGGCTGCCTGGTGG - Intergenic
1023016968 7:35978255-35978277 TGCTTCTCCAGGCTGCCTGGTGG - Intergenic
1026151285 7:67790081-67790103 ACATTCTCCGTGCACCCTGCTGG - Intergenic
1029464159 7:100714981-100715003 TGGGGCTCCGTGCTGCCTGGGGG + Intergenic
1029701240 7:102248298-102248320 TCCTGCTCCGTCCAGCCTGGAGG - Intronic
1032642854 7:133788854-133788876 AGATTCTCCATACAGCCTGAAGG - Intronic
1032867291 7:135939280-135939302 AGATTCTCTGTGAAGCCTGCTGG + Intronic
1034385161 7:150734813-150734835 TGATTCTCAGGGCAGCCTACAGG + Intronic
1034979748 7:155468124-155468146 TGGGTCTCCGTGGAGGCTGGGGG - Intergenic
1035205176 7:157290220-157290242 CGAGTCTCCATGCAGCCTTGAGG - Intergenic
1036941051 8:13052353-13052375 TGAGTCTGAATGCAGCCTGGAGG + Intergenic
1044079877 8:87869909-87869931 TGATTCTGCTTGCAGCTTGAAGG + Intergenic
1044191217 8:89319948-89319970 TGATTCTCCTTGCTGCCGCGTGG - Intergenic
1047088249 8:121543648-121543670 TCATTCTCCTTTCAGCCTGTGGG - Intergenic
1053071169 9:35102909-35102931 TGATTCTCCGAGGATCCTGAGGG - Intronic
1053667556 9:40326742-40326764 TAATTCTCCAAGCAGCCTCGTGG - Intronic
1054378699 9:64466769-64466791 TAATTCTCCAAGCAGCCTCGTGG - Intergenic
1054517055 9:66049543-66049565 TAATTCTCCAAGCAGCCTCGTGG + Intergenic
1060280074 9:122209748-122209770 GGATCCTGTGTGCAGCCTGGGGG - Intronic
1060760224 9:126240844-126240866 AGCTCCTCCGTTCAGCCTGGTGG - Intergenic
1061135074 9:128729196-128729218 TGCTTCTCTGTCCACCCTGGCGG + Intergenic
1061629198 9:131860944-131860966 TGAACCACCGAGCAGCCTGGTGG + Intronic
1185746140 X:2574952-2574974 TGATTCTCCTGGAGGCCTGGAGG - Intergenic
1192226894 X:69235126-69235148 TGATTCTCCTGGAAGCCTAGAGG + Intergenic
1192308402 X:69987944-69987966 TAATTCTCCTTGCTGCTTGGTGG - Intronic
1201749209 Y:17414003-17414025 TGGTTCCCCATGCAGCCTGTTGG + Intergenic
1202095794 Y:21247186-21247208 TGATTCTCTCTGTAGCCTCGGGG + Intergenic