ID: 1084426656

View in Genome Browser
Species Human (GRCh38)
Location 11:69087723-69087745
Sequence GACTCAGATGAGCCTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084426656 Original CRISPR GACTCAGATGAGCCTCAGGA TGG (reversed) Intronic
901957322 1:12795943-12795965 GACGGTGATGAGCCACAGGAAGG - Exonic
901965341 1:12861726-12861748 GACGGTGATGAGCCACAGGAAGG - Exonic
901973718 1:12928200-12928222 GACGGTGATGAGCCACAGGAAGG - Intronic
901980734 1:13032077-13032099 GACAGTGATGAGCCACAGGAAGG - Exonic
901988699 1:13095205-13095227 GACGGTGATGAGCCACAGGACGG + Intergenic
901993114 1:13131562-13131584 GACGGTGATGAGCCACAGGACGG - Intergenic
902001356 1:13196854-13196876 GACAGTGATGAGCCACAGGAAGG + Exonic
902011460 1:13273567-13273589 GACGGTGATGAGCCACAGGAAGG + Intergenic
902020593 1:13342559-13342581 GACGGTGATGAGCCACAGGAAGG + Exonic
902665221 1:17932961-17932983 GACTCAGAGGAGGCTCAGACAGG + Intergenic
904409081 1:30314102-30314124 GCCTCAGGTGATCCCCAGGAAGG - Intergenic
904834151 1:33324156-33324178 GACTCCACTCAGCCTCAGGATGG - Exonic
905741292 1:40373797-40373819 GACGCAGATGACCCTCTGGCCGG - Exonic
906353632 1:45084494-45084516 GTCTCAGATGAGACTTTGGATGG - Intronic
906528678 1:46511111-46511133 GACTCAGGTGAAGCTCAGCAGGG - Exonic
906581292 1:46937108-46937130 GAAGAAGCTGAGCCTCAGGAAGG + Intronic
906602429 1:47141787-47141809 GAAGAAGCTGAGCCTCAGGAAGG - Intronic
907342832 1:53749095-53749117 GCATCAGATGAGACTGAGGAAGG + Intergenic
907968856 1:59361012-59361034 TACTCAGGGGGGCCTCAGGATGG - Intronic
909502214 1:76347070-76347092 GAGTGAGATGACCCTTAGGACGG - Intronic
910975285 1:92900079-92900101 GACTGTAATGTGCCTCAGGAAGG + Intronic
913695233 1:121318215-121318237 GACCCAGATAAGCCAGAGGATGG - Intronic
914142331 1:144961845-144961867 GACCCAGATAAGCCAGAGGATGG + Intronic
915361809 1:155290422-155290444 GTCTCAGATAGGCCTCAGGTAGG + Exonic
920281672 1:204848083-204848105 GACTTAGAAGGGCCCCAGGAGGG + Intronic
920482564 1:206336594-206336616 GACCCAGATAAGCCAGAGGATGG - Intronic
921837534 1:219793707-219793729 GCCTCAGTAGAACCTCAGGAAGG + Intronic
923865341 1:237933505-237933527 GATTTTGCTGAGCCTCAGGAAGG - Intergenic
924927604 1:248698116-248698138 CACTTAGATGAACTTCAGGAAGG - Intergenic
1063456388 10:6185558-6185580 GACCCAGATGAGCCCCTGGCTGG - Intronic
1064353748 10:14600045-14600067 GACTCAGATGAGCTGTAGGAAGG - Intronic
1067514500 10:46926121-46926143 GTCTCAGGTGAGTCTCAGGTGGG + Intronic
1067647761 10:48125692-48125714 GTCTCAGGTGAGTCTCAGGTGGG - Intergenic
1067965247 10:50905342-50905364 CACTATGACGAGCCTCAGGATGG + Intergenic
1070857026 10:79614163-79614185 GACCAAGTGGAGCCTCAGGATGG - Exonic
1073308590 10:102523241-102523263 GAATCAGCTTAGCCACAGGAAGG + Intronic
1075506706 10:123029431-123029453 CATACAGATGAGCTTCAGGATGG - Intronic
1076896609 10:133316338-133316360 GACTCAGACAAGGCACAGGATGG + Intronic
1077560568 11:3257765-3257787 GACTCAGGTGGGACTCAGGTAGG - Intergenic
1078028096 11:7719018-7719040 GACTCTGATGAGAATCAGAATGG - Intergenic
1078048814 11:7943973-7943995 GACTATAATGTGCCTCAGGAAGG + Intergenic
1078132879 11:8627610-8627632 GACAAAGATGAGGCTCAGAAGGG + Intronic
1078652853 11:13212114-13212136 GACTCAGATTAGATACAGGATGG + Intergenic
1081021936 11:37958257-37958279 GTCTCAGATGAGACTTTGGACGG - Intergenic
1081322551 11:41708797-41708819 TTATCAGATGAACCTCAGGAGGG - Intergenic
1081523657 11:43907790-43907812 GAGACTCATGAGCCTCAGGAAGG + Intronic
1081796533 11:45824294-45824316 GACTCAGAGGAGCCTCAAGAAGG + Intergenic
1083263778 11:61536861-61536883 GCCTCTCAAGAGCCTCAGGATGG + Intronic
1084163494 11:67364121-67364143 GAGTCTGATGAGCACCAGGAGGG + Intronic
1084366394 11:68703628-68703650 AACTCAGATGTTCTTCAGGAGGG + Intergenic
1084426656 11:69087723-69087745 GACTCAGATGAGCCTCAGGATGG - Intronic
1084473556 11:69376589-69376611 GTCTCAAATGGGCCTCAGGCTGG + Intergenic
1084980005 11:72823883-72823905 GACCCAGATCAGTCCCAGGAAGG - Intronic
1086487597 11:87325118-87325140 GACTGAGATGACCCTCAGATTGG + Intergenic
1087253925 11:95934456-95934478 TACACAGAAGAGCCTCAGAAGGG + Intergenic
1088248267 11:107840171-107840193 GACACAGAGGAGCTCCAGGAGGG + Intronic
1088565361 11:111166748-111166770 GACTCAGATGGGAGGCAGGATGG + Intergenic
1089055984 11:115585317-115585339 GACCCACCTGAGCCTCAGGCAGG + Intergenic
1089252630 11:117176036-117176058 GAATCAGAGAATCCTCAGGATGG - Intronic
1090714221 11:129415957-129415979 GACTCTGAGGAGCCTAAGAAGGG - Intronic
1090855767 11:130608301-130608323 GTCTCAGAGGAGTTTCAGGAAGG - Intergenic
1090985242 11:131760752-131760774 GACGAGGAGGAGCCTCAGGAAGG + Intronic
1092409544 12:8243100-8243122 GGCTAAGGTGAGCCTTAGGAGGG + Intergenic
1093140144 12:15500233-15500255 CATTCTGATGAGCATCAGGAAGG + Intronic
1096407170 12:51352314-51352336 GACTCTGATAAGGCTCGGGAGGG - Exonic
1100097738 12:91064092-91064114 GAATCAGCATAGCCTCAGGATGG - Intergenic
1101440506 12:104701146-104701168 GACACAGATGAGGCTCAGAGGGG + Intronic
1103740764 12:123089945-123089967 GACTCAGTGGAGCCGCAGAAAGG + Intronic
1110604445 13:77415368-77415390 GACTGAGGTGAGACTCTGGAAGG + Intergenic
1111652902 13:91115238-91115260 GAGGCAGATGGGCTTCAGGATGG + Intergenic
1111857026 13:93651392-93651414 GAAACAGCTGAGCCTCAGGAAGG + Intronic
1113001350 13:105641637-105641659 TACTGAGATGTGGCTCAGGATGG - Intergenic
1113307093 13:109090507-109090529 GATGCAGAGGACCCTCAGGAAGG + Intronic
1113365944 13:109675956-109675978 GAAGCAAAAGAGCCTCAGGATGG + Intergenic
1113633298 13:111902685-111902707 GATTCTGATGAGCCTCAGAGAGG + Intergenic
1113939607 13:114011581-114011603 GGCTGAGATGAGCCCCAGGCAGG - Intronic
1114363581 14:22002961-22002983 GACAGAGAGGAGCCTCAAGAGGG + Intergenic
1122089713 14:99330295-99330317 GACTCAGATGGCCCTCAGCACGG - Intergenic
1122231357 14:100307577-100307599 GAGTCAGATCAGCCTTAGGCCGG + Intergenic
1123174265 14:106401813-106401835 GACTCATCTGAGGCTCAGGGCGG + Intergenic
1123182476 14:106482748-106482770 GACTCATCTGAGGCTCAGGGCGG + Intergenic
1202944425 14_KI270726v1_random:13981-14003 GACTCATCTGAGGCTCAGGGCGG - Intergenic
1126375256 15:47991144-47991166 CACCCAGAGGAGCCACAGGAGGG - Intergenic
1126733868 15:51712260-51712282 GGCTCAGATGGGGCTCAGAATGG + Intronic
1127653179 15:61029333-61029355 GCCTGAGATGAGACTGAGGAGGG + Intronic
1128456183 15:67832819-67832841 TACTCTGATTAGCCTCAGAATGG + Intronic
1128672370 15:69583849-69583871 GGCTCAGCAGAGCCCCAGGAGGG - Intergenic
1130236380 15:82138534-82138556 GACTGAGTTGAGCCATAGGAAGG + Intronic
1131547537 15:93328477-93328499 GTCTCTGGTGAGCCTCAGCAGGG - Intergenic
1131582859 15:93662294-93662316 GACAAATATGAGTCTCAGGAGGG + Intergenic
1132893007 16:2213845-2213867 GACTCCGGTGAGGGTCAGGATGG + Exonic
1133905327 16:10016856-10016878 CACTCACATGAGCAGCAGGATGG + Intronic
1133998848 16:10767077-10767099 GCCTCAGGTGAACCCCAGGAGGG - Exonic
1134409894 16:13995164-13995186 GACTCAGATGTCCCCCAGTAAGG + Intergenic
1136628968 16:31478119-31478141 GTATCAGATGAGCCTGAGGCTGG + Intergenic
1139576584 16:67846326-67846348 GACTCAAATGTCCCTCAGGTGGG - Intronic
1140030074 16:71328621-71328643 GACTAAGAGGTGACTCAGGATGG + Intergenic
1140038467 16:71389505-71389527 GAGGCAGCTGAGTCTCAGGAAGG + Intronic
1143262956 17:5614017-5614039 GACTCAGAGAAGCCTGAGGGGGG - Intronic
1143670197 17:8391691-8391713 GACTGTGAAGAGCCTCAGGTTGG - Exonic
1143968714 17:10776808-10776830 GAGTCAGATGACCCCCAGGTGGG + Intergenic
1144167956 17:12630994-12631016 GATTCAGATAAGCCTGAGAATGG - Intergenic
1145271134 17:21405539-21405561 GAGGAAGCTGAGCCTCAGGAAGG + Intronic
1145367185 17:22274023-22274045 GACTCAGAGGATCTTCAGGCAGG - Intergenic
1145911824 17:28547557-28547579 GACACAGAAGAGCCCCAGGGTGG + Intronic
1148508057 17:48143951-48143973 GAAGCAGATGAGTCTCAGCAGGG + Intronic
1153224095 18:2884770-2884792 AACTCAGATCAGCCTCAGGAAGG - Intronic
1155502040 18:26496442-26496464 GACTCTTATGAGCCTCTGAAAGG + Intronic
1155631439 18:27898139-27898161 AACTCAGAAAAGCATCAGGAAGG - Intergenic
1157223164 18:45841355-45841377 GACTCAGGTGAGGCCCAGAAAGG + Intronic
1157812725 18:50709296-50709318 GACTCAGGAAGGCCTCAGGAAGG - Intronic
1158383880 18:56966915-56966937 AACTCAGAGGAGCCTGATGAAGG + Intronic
1158852010 18:61503995-61504017 TACTCAAATGAGCTCCAGGATGG - Intronic
1160406680 18:78651375-78651397 GAATGTGATGAGCTTCAGGAAGG - Intergenic
1160551864 18:79698529-79698551 GACACAGCTGAGGCACAGGAAGG - Intronic
1160979768 19:1811627-1811649 GACTCAGACGTGACTCAGGAAGG - Exonic
1161028622 19:2047949-2047971 GAAGCAGATGAGCCTCTGGTGGG - Intronic
1161878170 19:6928018-6928040 GACTCAGATGATGCTCAGGATGG - Intronic
1163202208 19:15777493-15777515 GACTCTAATGTCCCTCAGGATGG + Intergenic
1167036522 19:46998339-46998361 GGCTCAGAAGAACCACAGGAGGG - Intronic
925028279 2:626708-626730 CACTGCGCTGAGCCTCAGGAGGG + Intergenic
925827875 2:7868013-7868035 CCCTCAGATGAGCCTCAGGTTGG + Intergenic
926151016 2:10425544-10425566 GACTCAGACCAGCACCAGGACGG - Intronic
926521382 2:13919698-13919720 GTCTCAGGTGAACCTCAGAAGGG - Intergenic
929802980 2:45120250-45120272 GATTCAGAGGAGCCAAAGGAAGG + Intergenic
930712853 2:54565439-54565461 GCCTCAGATGACCCTCAGGTGGG + Intronic
935856411 2:107279295-107279317 GACACAGATGTGCCTCATCATGG + Intergenic
936550875 2:113438328-113438350 GAGGTAGATGAGCGTCAGGAAGG - Intronic
937265378 2:120611933-120611955 TCCTCAGAGGAGGCTCAGGATGG - Intergenic
937394939 2:121526378-121526400 GGCTCAGATGTGCCCCAGTAGGG - Intronic
938901659 2:135803688-135803710 GACTCTGATCGGCCTCAGGTGGG - Intronic
941018699 2:160385657-160385679 AACTGAGAAGAGCATCAGGAAGG + Intronic
941425316 2:165337516-165337538 GACTAAGATGTGCCTAAGTATGG - Intronic
943245890 2:185450753-185450775 GTCTCAGATGAGACACTGGATGG - Intergenic
944657731 2:201892643-201892665 AACTGAGATGAGCCACAAGAGGG + Intronic
944942495 2:204643867-204643889 TACTCAGGTTAGCTTCAGGAGGG - Intronic
947166066 2:227263795-227263817 GCCTCAGAGGAGCCCCTGGATGG + Exonic
948825297 2:240570965-240570987 GCCTGAGAAGGGCCTCAGGAGGG + Intronic
1168790797 20:574570-574592 GACTCAGGTGACCTTCAGGTTGG + Intergenic
1169191630 20:3661903-3661925 GACTCAAGGGAGCATCAGGAAGG - Intronic
1170324718 20:15144028-15144050 GACCCACATGAGGCCCAGGATGG - Intronic
1170412468 20:16106317-16106339 GACTCAGATGAGCATGGGGAGGG + Intergenic
1172013047 20:31857553-31857575 GAGGCAGATGAGGCCCAGGAGGG - Intronic
1174079427 20:47960566-47960588 TCCTCAGAACAGCCTCAGGATGG + Intergenic
1174138237 20:48395144-48395166 TCCTCAGATCAGCCTCAGGATGG - Intergenic
1174205848 20:48838147-48838169 GATTCAGATGAGCCGCACAAAGG + Intergenic
1174463717 20:50701106-50701128 GCCTGAAATGAGGCTCAGGATGG - Intergenic
1174687319 20:52468392-52468414 GACTCAGATGAAACACAGGAAGG + Intergenic
1175366276 20:58458353-58458375 GACTCAGCTGGGCCTCTCGAGGG + Intergenic
1176092432 20:63325198-63325220 GACCCAGAGGGGCCACAGGAGGG + Intronic
1179035971 21:37759073-37759095 CACTCAGCTGAGCCTCAGATAGG - Intronic
1181891609 22:26068471-26068493 GGCTCAGATGAGCCTGAAGTGGG - Intergenic
1185326413 22:50227891-50227913 AGCTCAGGTGAGCCTCAGCATGG - Exonic
950215656 3:11156380-11156402 CACTCAGCTGAGGGTCAGGAAGG - Intronic
950220949 3:11195753-11195775 GCTGCAGATGAGCTTCAGGAAGG + Intronic
950362157 3:12457140-12457162 GACACAGAAGAACCACAGGATGG - Intergenic
950924074 3:16722675-16722697 GACTCTGGAGAGCCTCTGGATGG + Intergenic
952330328 3:32358834-32358856 GCCTCAGATGGGCATCAGGAGGG + Intronic
954116641 3:48470311-48470333 GACTGAGAGAAGCCCCAGGAGGG + Intronic
956336237 3:68167084-68167106 TATTCAAATGAGCCTCAGGGAGG + Intronic
960814610 3:121659862-121659884 GCCTCAGAGGAGCCACAGGAAGG - Intronic
960903773 3:122577685-122577707 GACTCAGAGCAGCGGCAGGAAGG - Exonic
961629114 3:128283339-128283361 AACTCAGATGAGCATAAGGAAGG + Intronic
962128938 3:132651928-132651950 GTCTCAGATGAGACTTTGGACGG + Intronic
962750522 3:138431737-138431759 GACACAGAGGAGACACAGGAAGG - Intergenic
967501686 3:190204633-190204655 GTCTCAGATGAGACTTTGGATGG + Intergenic
969117151 4:4877881-4877903 GGCTTGGAGGAGCCTCAGGATGG + Intergenic
969723182 4:8904582-8904604 GCCTCCTCTGAGCCTCAGGAGGG + Intergenic
971698548 4:29937375-29937397 AGCTCAGATGATTCTCAGGAGGG + Intergenic
975097884 4:70478388-70478410 TAATCACATGAGCCTCACGAAGG - Intronic
975097959 4:70479275-70479297 CAATCACATGAGCCTCACGATGG + Intronic
975220130 4:71804967-71804989 GACTCAGAAGAGCCTAAACAGGG - Intergenic
975220701 4:71809478-71809500 GACTCAGAAGAGCCTAAACAGGG - Intergenic
976199278 4:82562537-82562559 GACTCAGACGAGACCCAGGGAGG - Intergenic
979303136 4:119110358-119110380 GCCTCAGATGCGCATCTGGAAGG - Intergenic
986455202 5:7911739-7911761 GTCTCAGATGAGGCTTTGGATGG - Intergenic
990941359 5:61206009-61206031 GTCTCAGATGAGACTTTGGATGG - Intergenic
991267631 5:64740685-64740707 AAGGCAGCTGAGCCTCAGGATGG + Intronic
992759670 5:79940186-79940208 ACCACAGCTGAGCCTCAGGAAGG + Intergenic
995804789 5:116039118-116039140 GACTCAGTTGTACCCCAGGAGGG + Intronic
998391733 5:141791296-141791318 GACGCAGTTGAGGCTCAGGGAGG - Intergenic
1003324813 6:5084200-5084222 GACTTAGATGGCCCTCAGGGTGG + Intergenic
1003349509 6:5302832-5302854 GACTGAGATCAGCATAAGGAGGG + Intronic
1005956888 6:30670433-30670455 GGCTCAGAAGCGCCTCAAGATGG - Exonic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007232146 6:40355857-40355879 GTCACAGCTGAGCTTCAGGAAGG - Intergenic
1007778533 6:44237789-44237811 TACCAGGATGAGCCTCAGGATGG + Intergenic
1008102012 6:47401738-47401760 GTGTCAGATGTGCCGCAGGATGG - Intergenic
1010204392 6:73309682-73309704 GACTCGGAACAGCCTCTGGAAGG + Exonic
1012383172 6:98644776-98644798 TACTCATATGTGGCTCAGGATGG - Intergenic
1012739601 6:102999417-102999439 GACTCAGATGATCCTCATGATGG - Intergenic
1015893343 6:137991096-137991118 CATTCAGATGAGTCTCAGAAAGG + Intergenic
1018716929 6:166540507-166540529 CACTCATATGAACTTCAGGATGG - Intronic
1019524477 7:1474536-1474558 GACTGAGCTGGGCCTCAGGTGGG - Intronic
1021604880 7:22399923-22399945 GCCTCAGTTCAGCCTCTGGATGG - Intergenic
1021779718 7:24091335-24091357 GACACAGATGAGGTTGAGGAGGG + Intergenic
1022537519 7:31107157-31107179 GACTGAGAAGAGCCCCAGGGTGG - Exonic
1022990830 7:35705506-35705528 GTCTCAGCTGGGCCTGAGGAAGG - Intergenic
1026835902 7:73638903-73638925 GACTTAAATGAGCCCCAGCATGG - Intergenic
1030505274 7:110414076-110414098 GAATCAGATAAGCGTCATGAAGG - Intergenic
1033720142 7:144050529-144050551 CAGCCAGATGAGCCCCAGGATGG - Exonic
1033737078 7:144232694-144232716 CAGTGAGATGAGCCCCAGGATGG + Exonic
1033738784 7:144251454-144251476 CAGTGAGATGAGCCCCAGGATGG + Intergenic
1033744263 7:144299500-144299522 CAGTGAGATGAGCCCCAGGATGG - Intergenic
1033745979 7:144318252-144318274 CAGTGAGATGAGCCCCAGGATGG - Exonic
1035488802 7:159253848-159253870 GCTTCAGAGGAGCCTAAGGAAGG + Intergenic
1036049321 8:5178588-5178610 GCCTCGGATGAGCATGAGGAAGG + Intergenic
1036747921 8:11423429-11423451 ATCTCAGAGGAGGCTCAGGATGG + Exonic
1037537287 8:19836426-19836448 GACACAGATGAGACACTGGACGG - Intronic
1040387258 8:46921876-46921898 GACTCACAAGAGCCCCATGAAGG - Intergenic
1040552001 8:48444973-48444995 GTCACAGATCAGCCTCTGGAGGG - Intergenic
1044111598 8:88281918-88281940 GACACAGATGAGCTTGTGGATGG - Intronic
1045337167 8:101216487-101216509 GACTATAATGTGCCTCAGGAAGG - Intergenic
1046011772 8:108557229-108557251 GACTCAGAGAAGCTTCAGTAGGG + Intergenic
1046014400 8:108588508-108588530 AAATCAATTGAGCCTCAGGAAGG - Intergenic
1049710774 8:144062390-144062412 GCCTCAGCTGGGCCTCAGGATGG - Intronic
1049770474 8:144378281-144378303 GACTCAGATGAGCTTTGGGTGGG - Intronic
1049902060 9:178488-178510 GAGGTAGATGAGCGTCAGGAAGG + Intronic
1051128804 9:13835816-13835838 GTCTCAGATGAGACTTTGGATGG + Intergenic
1051617596 9:19021100-19021122 TAATCAGCTGAGCATCAGGAGGG - Intronic
1052251052 9:26397859-26397881 TACTCAGCTCAACCTCAGGAGGG - Intergenic
1053217073 9:36280530-36280552 GATTCAGAAGAGCATCAGGATGG - Intronic
1053745094 9:41188777-41188799 GAGGTAGATGAGCGTCAGGAAGG + Intronic
1054482179 9:65676436-65676458 GAGGTAGATGAGCGTCAGGAAGG - Intronic
1054683253 9:68242491-68242513 GAGGTAGATGAGCGTCAGGAAGG - Intronic
1054877974 9:70116346-70116368 GATTCAGATGGGCATGAGGAAGG - Intronic
1056753260 9:89366868-89366890 GAGTCACAGGAGCCTCTGGAAGG + Intronic
1057794383 9:98145100-98145122 CACCCAGATGAGCCTTTGGAGGG + Intronic
1060431608 9:123555596-123555618 GGCTCAATTGATCCTCAGGAAGG + Intronic
1061314407 9:129785706-129785728 GTCACAGATGAGCAGCAGGAAGG + Intergenic
1185775594 X:2800629-2800651 GACACAGACAAGCTTCAGGATGG + Intronic
1185801799 X:3017801-3017823 GACTCAGATGTGCCACAGTAAGG - Intronic
1186527047 X:10258245-10258267 GTCTCAGAGGAGTCTCAGGGTGG + Intergenic
1190121598 X:47664473-47664495 GACTCTGATGTGCCTCAGCATGG + Intergenic
1190514400 X:51207644-51207666 GTCTCAGATGAGACTTTGGACGG + Intergenic
1192856441 X:75017629-75017651 GTCTCAGATGAGACTTTGGACGG - Intergenic
1194379793 X:93177999-93178021 GACACAAAGGTGCCTCAGGAGGG - Intergenic
1194502371 X:94697566-94697588 GTCTCAGGTGAGCCTGAGGATGG + Intergenic
1195028820 X:100906545-100906567 GAGTCAGATGACCCTCAGAGAGG + Intergenic
1197412659 X:126138583-126138605 GCCTGAGGTGAACCTCAGGAAGG + Intergenic
1198488153 X:137109033-137109055 CACTCAGATGATCCTAAGTAGGG + Intergenic
1200540799 Y:4453622-4453644 GTCTCAGATGAGACTTTGGACGG + Intergenic
1200979344 Y:9247893-9247915 GACCTAGATGGGCCTCAGGTGGG + Intergenic
1201062494 Y:10059622-10059644 GACCTAGATGGGCCTCAGGAGGG - Intergenic
1202111682 Y:21427629-21427651 GACCTAGATGGGCCTCAGGTGGG - Intergenic