ID: 1084429815

View in Genome Browser
Species Human (GRCh38)
Location 11:69104923-69104945
Sequence CTGGCAGCACAGGTGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084429805_1084429815 11 Left 1084429805 11:69104889-69104911 CCAGCCACATCTCCAAGGTGGAC No data
Right 1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG No data
1084429806_1084429815 7 Left 1084429806 11:69104893-69104915 CCACATCTCCAAGGTGGACTTGG No data
Right 1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG No data
1084429808_1084429815 -1 Left 1084429808 11:69104901-69104923 CCAAGGTGGACTTGGTCCCAGCC No data
Right 1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084429815 Original CRISPR CTGGCAGCACAGGTGAAGCT GGG Intergenic
No off target data available for this crispr