ID: 1084431640

View in Genome Browser
Species Human (GRCh38)
Location 11:69114583-69114605
Sequence GGCCCCAGAAGGACCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084431640_1084431644 -10 Left 1084431640 11:69114583-69114605 CCTACAGGGGTCCTTCTGGGGCC No data
Right 1084431644 11:69114596-69114618 TTCTGGGGCCTGAGGCCAGGTGG No data
1084431640_1084431645 -3 Left 1084431640 11:69114583-69114605 CCTACAGGGGTCCTTCTGGGGCC No data
Right 1084431645 11:69114603-69114625 GCCTGAGGCCAGGTGGTCACTGG No data
1084431640_1084431647 -2 Left 1084431640 11:69114583-69114605 CCTACAGGGGTCCTTCTGGGGCC No data
Right 1084431647 11:69114604-69114626 CCTGAGGCCAGGTGGTCACTGGG No data
1084431640_1084431649 12 Left 1084431640 11:69114583-69114605 CCTACAGGGGTCCTTCTGGGGCC No data
Right 1084431649 11:69114618-69114640 GTCACTGGGCCCCTGCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084431640 Original CRISPR GGCCCCAGAAGGACCCCTGT AGG (reversed) Intergenic
No off target data available for this crispr