ID: 1084439216

View in Genome Browser
Species Human (GRCh38)
Location 11:69161706-69161728
Sequence GGATAAATGAATAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084439212_1084439216 13 Left 1084439212 11:69161670-69161692 CCGTAGCCCATGGAACGGAGACA No data
Right 1084439216 11:69161706-69161728 GGATAAATGAATAATGATGATGG No data
1084439209_1084439216 26 Left 1084439209 11:69161657-69161679 CCACAGATGTAAACCGTAGCCCA No data
Right 1084439216 11:69161706-69161728 GGATAAATGAATAATGATGATGG No data
1084439213_1084439216 7 Left 1084439213 11:69161676-69161698 CCCATGGAACGGAGACAGTGAAG No data
Right 1084439216 11:69161706-69161728 GGATAAATGAATAATGATGATGG No data
1084439214_1084439216 6 Left 1084439214 11:69161677-69161699 CCATGGAACGGAGACAGTGAAGA No data
Right 1084439216 11:69161706-69161728 GGATAAATGAATAATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084439216 Original CRISPR GGATAAATGAATAATGATGA TGG Intergenic
No off target data available for this crispr