ID: 1084439612

View in Genome Browser
Species Human (GRCh38)
Location 11:69165115-69165137
Sequence CTCTGGACACCAAGGCTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084439603_1084439612 9 Left 1084439603 11:69165083-69165105 CCCACGTGATCGTGATCAAGCCC No data
Right 1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG No data
1084439604_1084439612 8 Left 1084439604 11:69165084-69165106 CCACGTGATCGTGATCAAGCCCC No data
Right 1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084439612 Original CRISPR CTCTGGACACCAAGGCTCCG GGG Intergenic
No off target data available for this crispr