ID: 1084439809

View in Genome Browser
Species Human (GRCh38)
Location 11:69166370-69166392
Sequence CTCCACATGCAGACCGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084439809_1084439813 -8 Left 1084439809 11:69166370-69166392 CCATGGCCGGTCTGCATGTGGAG No data
Right 1084439813 11:69166385-69166407 ATGTGGAGGAAAAGATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084439809 Original CRISPR CTCCACATGCAGACCGGCCA TGG (reversed) Intergenic
No off target data available for this crispr