ID: 1084440461

View in Genome Browser
Species Human (GRCh38)
Location 11:69169876-69169898
Sequence CTGGGCCAGGCCATCATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084440461_1084440473 20 Left 1084440461 11:69169876-69169898 CCCACAATGATGGCCTGGCCCAG No data
Right 1084440473 11:69169919-69169941 CAAAAGCATTTGCTGCCTGTCGG No data
1084440461_1084440474 21 Left 1084440461 11:69169876-69169898 CCCACAATGATGGCCTGGCCCAG No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084440461 Original CRISPR CTGGGCCAGGCCATCATTGT GGG (reversed) Intergenic
No off target data available for this crispr