ID: 1084440474

View in Genome Browser
Species Human (GRCh38)
Location 11:69169920-69169942
Sequence AAAAGCATTTGCTGCCTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084440469_1084440474 -10 Left 1084440469 11:69169907-69169929 CCTCCGCCTCCTCAAAAGCATTT No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data
1084440461_1084440474 21 Left 1084440461 11:69169876-69169898 CCCACAATGATGGCCTGGCCCAG No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data
1084440465_1084440474 2 Left 1084440465 11:69169895-69169917 CCAGCACCCCATCCTCCGCCTCC No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data
1084440463_1084440474 8 Left 1084440463 11:69169889-69169911 CCTGGCCCAGCACCCCATCCTCC No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data
1084440464_1084440474 3 Left 1084440464 11:69169894-69169916 CCCAGCACCCCATCCTCCGCCTC No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data
1084440467_1084440474 -5 Left 1084440467 11:69169902-69169924 CCCATCCTCCGCCTCCTCAAAAG No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data
1084440462_1084440474 20 Left 1084440462 11:69169877-69169899 CCACAATGATGGCCTGGCCCAGC No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data
1084440468_1084440474 -6 Left 1084440468 11:69169903-69169925 CCATCCTCCGCCTCCTCAAAAGC No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data
1084440466_1084440474 -4 Left 1084440466 11:69169901-69169923 CCCCATCCTCCGCCTCCTCAAAA No data
Right 1084440474 11:69169920-69169942 AAAAGCATTTGCTGCCTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084440474 Original CRISPR AAAAGCATTTGCTGCCTGTC GGG Intergenic
No off target data available for this crispr