ID: 1084440688

View in Genome Browser
Species Human (GRCh38)
Location 11:69171076-69171098
Sequence CTGCACTTTGTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084440683_1084440688 -5 Left 1084440683 11:69171058-69171080 CCTGGCATTTTGAACTCCCTGCA No data
Right 1084440688 11:69171076-69171098 CTGCACTTTGTGGGAAAAACAGG No data
1084440682_1084440688 9 Left 1084440682 11:69171044-69171066 CCTCGGACATGTGGCCTGGCATT No data
Right 1084440688 11:69171076-69171098 CTGCACTTTGTGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084440688 Original CRISPR CTGCACTTTGTGGGAAAAAC AGG Intergenic
No off target data available for this crispr