ID: 1084441299

View in Genome Browser
Species Human (GRCh38)
Location 11:69175204-69175226
Sequence TGAGTTTGCCAGAACTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084441299_1084441305 20 Left 1084441299 11:69175204-69175226 CCAGCTGAGTTCTGGCAAACTCA No data
Right 1084441305 11:69175247-69175269 CCCCTCTCTGAGAGAATTGAAGG No data
1084441299_1084441302 -8 Left 1084441299 11:69175204-69175226 CCAGCTGAGTTCTGGCAAACTCA No data
Right 1084441302 11:69175219-69175241 CAAACTCAGGGCAGCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084441299 Original CRISPR TGAGTTTGCCAGAACTCAGC TGG (reversed) Intergenic
No off target data available for this crispr